FLJ00094

Product ID	ORK06950
Accession No	AK024491
Clone name	as00094
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4149 bp) Predicted protein sequence (376 aa)
Source	Human spleen

Length: 4149 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Length: 376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15781	3.2e-131	100.0	FLJ00094 protei...	Homo sapiens
EAW85692	5.8e-131	99.7	SRY (sex determ...	Homo sapiens
AAF37424	3.1e-105	99.7	transcription f...	Homo sapiens
P57073	3.9e-105	99.7	Transcription f...	Homo sapiens
CAB75612	4.4e-105	99.7	c394H11.1 (simi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	ACCAAGCTGTGAAACTAAACC
Primer_r	GGCGCTATTGTATGCTCTATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles