Gene/Protein Characteristic Table for FLJ00101
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05879
Accession No AK024495
Clone name as00101
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4659 bp)
Predicted protein sequence (294 aa)
Source Human spleen
Rouge ID mFLJ00101 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4659 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 294 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15785 8e-114 100.0 FLJ00101 protei...
Homo sapiens
EAX02343 1.9e-113 99.7 leucine rich re...
Homo sapiens
EAX02342 6.8e-101 100.0 leucine rich re...
Homo sapiens
Q8IYG6 6.8e-101 100.0 Leucine-rich re...
Homo sapiens
XP_001085909 1.2e-95 88.4 similar to CG14...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 140 153 PR00019 Leucine-rich repeat
IPR001611 159 172 PR00019 Leucine-rich repeat
HMMPfam IPR001611 117 138 PF00560 Leucine-rich repeat
IPR001611 139 160 PF00560 Leucine-rich repeat
IPR001611 161 182 PF00560 Leucine-rich repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGGACCAACTGAAGCTGAACG
Primer_r ATGTTGTTGTAGGAGGCGTAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp