Gene/Protein Characteristic Table for FLJ00108
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05078
Accession No AK024499
Clone name as00108
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4292 bp)
Predicted protein sequence (216 aa)
Source Human spleen
Rouge ID mFLJ00108 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4292 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 216 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15789 6.4e-85 100.0 FLJ00108 protei...
Homo sapiens
EAW82605 1.1e-83 99.1 spondin 2, extr...
Homo sapiens
XP_001141566 3.7e-25 91.9 spondin 2, extr...
Pan troglodytes
Q9BUD6 4.1e-25 91.9 Spondin-2; Mind...
Homo sapiens
BAA85892 4.1e-25 91.9 spondin 2 [Homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018305 3.1e-08 46.4 KIAA0762
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR009465 1 100 PF06468 Spondin
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTGTCCGAGGTTGCTATGGTG
Primer_r GAACTGGACCAAGCAAAGGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp