KIAA0762

Product ID	ORK06967
Accession No	AB018305
Description	spondin 1, extracellular matrix protein
Clone name	hk04668s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4301 bp) Predicted protein sequence (724 aa)
Source	Human adult brain
Rouge ID	mKIAA0762 by Kazusa Mouse cDNA Project
Note	We replaced hk04668, former representative clones for KIAA0762 with hk04668s1. (2002/5/10)

Length: 4301 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2124 bp
Genome contig ID	gi51511727f_13860979
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CATTTTGGAAATAAAGATTTTTTACTACAAAAATG
Flanking genome sequence (384956 - 385005)	----+--------+--------+--------+--------+----* AAATTTGTTTGGACTTCCACTTGAGACAGTAAAGAGAGTATTAGACACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	13960979	14245933	15	100.0	Perfect prediction

Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCB6	100.0	Spondin-1; F-sp...	Homo sapiens
XP_508295	99.7	spondin 1, extr...	Pan troglodytes
BAB18461	99.7	VSGP/F-spondin ...	Homo sapiens
XP_001093336	99.6	spondin 1, extr...	Macaca mulatta
BAC11217	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037733	5.1e-15	26.4	KIAA1312
AB011177	8.2e-14	28.2	KIAA0605
AB011122	2.9e-13	31.7	KIAA0550
AB023177	5.1e-11	26.6	KIAA0960
AB002364	3.7e-09	29.5	KIAA0366

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002861	1	90	PF02014	Reeler region
	IPR009465	91	332	PF06468	Spondin
	IPR000884	363	411	PF00090	Thrombospondin
	IPR000884	422	471	PF00090	Thrombospondin
	IPR000884	479	527	PF00090	Thrombospondin
	IPR000884	535	582	PF00090	Thrombospondin
	IPR000884	589	637	PF00090	Thrombospondin
	IPR000884	675	724	PF00090	Thrombospondin
HMMSmart	IPR000884	362	412	SM00209	Thrombospondin
	IPR000884	421	472	SM00209	Thrombospondin
	IPR000884	478	528	SM00209	Thrombospondin
	IPR000884	534	583	SM00209	Thrombospondin
	IPR000884	588	638	SM00209	Thrombospondin
	IPR000884	674	723	SM00209	Thrombospondin
ProfileScan	IPR002861	1	111	PS51019	Reeler region
	IPR009465	112	305	PS51020	Spondin
	IPR000884	359	412	PS50092	Thrombospondin
	IPR000884	418	472	PS50092	Thrombospondin
	IPR000884	475	528	PS50092	Thrombospondin
	IPR000884	531	583	PS50092	Thrombospondin
	IPR000884	585	638	PS50092	Thrombospondin
	IPR000884	671	723	PS50092	Thrombospondin

Primer_f	GCAATGTTGTTCTAAGCTATC
Primer_r	AACAATCCAACAAGAGTCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAATGTTGTTCTAAGCTATC
Primer_r	AACAATCCAACAAGAGTCATG
PCR product length	202 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles