Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00559 |
---|---|
Accession No | AB011122 |
Description | adhesion G protein-coupled receptor B3 |
Clone name | hh15909 |
Vector information | |
cDNA sequence | DNA sequence (5420 bp) Predicted protein sequence (1524 aa) |
HaloTag ORF Clone |
FHC00559
|
Flexi ORF Clone | FXC00559 |
Source | Human adult brain |
Rouge ID |
mKIAA0550
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00851, former representative clones for KIAA0550 with hh15909. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 614 bp |
---|---|
Genome contig ID | gi89161210f_69302564 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (853556 - 853605) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 69402564 | 70156118 | 32 | 99.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR008077 | 57 | 74 | PR01694 | Brain-specific angiogenesis inhibitor |
IPR008077 | 539 | 551 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR008077 | 559 | 575 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR008077 | 616 | 635 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR008077 | 658 | 667 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR008077 | 719 | 740 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR000832 | 881 | 905 | PR00249 | GPCR | |
IPR008077 | 905 | 915 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR000832 | 945 | 968 | PR00249 | GPCR | |
IPR008077 | 969 | 982 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR000832 | 982 | 1007 | PR00249 | GPCR | |
IPR008077 | 1008 | 1025 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR000832 | 1025 | 1050 | PR00249 | GPCR | |
IPR000832 | 1100 | 1120 | PR00249 | GPCR | |
IPR008077 | 1121 | 1131 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR000832 | 1131 | 1152 | PR00249 | GPCR | |
IPR008077 | 1185 | 1198 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR008077 | 1413 | 1427 | PR01694 | Brain-specific angiogenesis inhibitor | |
IPR008077 | 1430 | 1444 | PR01694 | Brain-specific angiogenesis inhibitor | |
HMMPfam | IPR000884 | 297 | 344 | PF00090 | Thrombospondin |
IPR000884 | 351 | 399 | PF00090 | Thrombospondin | |
IPR000884 | 406 | 454 | PF00090 | Thrombospondin | |
IPR000884 | 461 | 509 | PF00090 | Thrombospondin | |
IPR001879 | 513 | 574 | PF02793 | Hormone receptor | |
IPR000203 | 817 | 865 | PF01825 | GPS | |
IPR000832 | 876 | 1156 | PF00002 | GPCR | |
HMMSmart | IPR000884 | 296 | 345 | SM00209 | Thrombospondin |
IPR000884 | 350 | 400 | SM00209 | Thrombospondin | |
IPR000884 | 405 | 455 | SM00209 | Thrombospondin | |
IPR000884 | 460 | 510 | SM00209 | Thrombospondin | |
IPR001879 | 512 | 578 | SM00008 | Hormone receptor | |
IPR000203 | 817 | 870 | SM00303 | GPS | |
ProfileScan | IPR000859 | 32 | 161 | PS01180 | CUB |
IPR000884 | 293 | 345 | PS50092 | Thrombospondin | |
IPR000884 | 347 | 400 | PS50092 | Thrombospondin | |
IPR000884 | 402 | 455 | PS50092 | Thrombospondin | |
IPR000884 | 457 | 510 | PS50092 | Thrombospondin | |
IPR001879 | 493 | 573 | PS50227 | Hormone receptor | |
IPR000203 | 818 | 870 | PS50221 | GPS | |
IPR000832 | 879 | 1153 | PS50261 | GPCR | |
ScanRegExp | IPR000832 | 1141 | 1156 | PS00650 | GPCR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 5 | AVRNLLIYIFSTYLLVMFGFNAA | 27 | PRIMARY | 23 | 2 | 881 | VTLIVGSGLSCLALITLAVVYAA | 903 | PRIMARY | 23 | 3 | 912 | RSIILINFCLSIISSNILILVG | 933 | SECONDARY | 22 | 4 | 943 | CTTTTAFLHFFFLASFCWVLTEA | 965 | SECONDARY | 23 | 5 | 985 | FLCLGWGLPALVVATSVGF | 1003 | SECONDARY | 19 | 6 | 1025 | YAFVGPAAAVVLVNMVIGILVFN | 1047 | PRIMARY | 23 | 7 | 1101 | LWSSCVVLPLLALTWMSAVLAMT | 1123 | PRIMARY | 23 | 8 | 1130 | FQILFAVFDSLQGFVIVMVHCIL | 1152 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | ATCATTTCACATACCTCCTGC |
---|---|
Primer_r | GGATAAGGATGAGGAGGGGAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCATTTCACATACCTCCTGC |
Primer_r | GGATAAGGATGAGGAGGGGAC |
PCR product length | 127 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |