Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05865 |
---|---|
Accession No | AB018311 |
Description | adhesion G protein-coupled receptor L3 |
Clone name | hk05006 |
Vector information | |
cDNA sequence | DNA sequence (4150 bp) Predicted protein sequence (872 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0768
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000832 | 291 | 315 | PR00249 | GPCR |
IPR003924 | 316 | 331 | PR01444 | Latrophilin receptor | |
IPR000832 | 354 | 377 | PR00249 | GPCR | |
IPR000832 | 392 | 417 | PR00249 | GPCR | |
IPR000832 | 434 | 459 | PR00249 | GPCR | |
IPR000832 | 508 | 529 | PR00249 | GPCR | |
IPR003924 | 530 | 542 | PR01444 | Latrophilin receptor | |
HMMPfam | IPR000203 | 226 | 273 | PF01825 | GPS |
IPR000832 | 286 | 533 | PF00002 | GPCR | |
IPR003334 | 542 | 872 | PF02354 | Latrophilin | |
HMMSmart | IPR000203 | 226 | 278 | SM00303 | GPS |
ProfileScan | IPR000203 | 227 | 278 | PS50221 | GPS |
IPR000832 | 289 | 530 | PS50261 | GPCR | |
ScanRegExp | IPR000832 | 518 | 533 | PS00650 | GPCR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 289 | LDVITWVGILLSLVCLLICIFTF | 311 | PRIMARY | 23 | 2 | 323 | TIHKNLCISLFVAELLFLIGIN | 344 | SECONDARY | 22 | 3 | 358 | LLHFFFLAAFTWMFLEGVQLYIM | 380 | PRIMARY | 23 | 4 | 395 | FYLVGYGMPALIVAVSAAVD | 414 | PRIMARY | 20 | 5 | 434 | WSFIGPATLIIMLNVIFLGIALY | 456 | PRIMARY | 23 | 6 | 477 | SWVIGAIALLCLLGLTWAFGLMY | 499 | PRIMARY | 23 | 7 | 507 | MAYLFTIFNSLQGMFIFIFHCVL | 529 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | AGCAGTTCATCACCAGGACAC |
---|---|
Primer_r | TGACCTTCCAATGCTTACGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |