Order Kazusa clone(s) from : ![]() |
Product ID | ORK00840 |
---|---|
Accession No | AB040878 |
Description | sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B, transcript variant 1 |
Clone name | fg03469b |
Vector information | |
cDNA sequence | DNA sequence (4559 bp) Predicted protein sequence (1202 aa) |
HaloTag ORF Clone |
FHC00840
![]() |
Flexi ORF Clone | FXC00840 |
Source | Human fetal brain |
Rouge ID |
mKIAA1445
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 950 bp |
---|---|
Genome contig ID | gi89161205r_124010730 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 124110730 | 124229115 | 23 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR008085 | 905 | 918 | PR01705 | Thrombospondin |
IPR008085 | 923 | 934 | PR01705 | Thrombospondin | |
IPR008085 | 942 | 953 | PR01705 | Thrombospondin | |
HMMPfam | IPR001627 | 177 | 588 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 606 | 653 | PF01437 | Plexin | |
IPR000884 | 719 | 770 | PF00090 | Thrombospondin | |
IPR000884 | 777 | 821 | PF00090 | Thrombospondin | |
IPR000884 | 908 | 958 | PF00090 | Thrombospondin | |
IPR000884 | 965 | 1015 | PF00090 | Thrombospondin | |
IPR000884 | 1020 | 1060 | PF00090 | Thrombospondin | |
HMMSmart | IPR001627 | 177 | 588 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 606 | 653 | SM00423 | Plexin/semaphorin/integrin | |
IPR000884 | 718 | 771 | SM00209 | Thrombospondin | |
IPR000884 | 776 | 822 | SM00209 | Thrombospondin | |
IPR000884 | 907 | 959 | SM00209 | Thrombospondin | |
IPR000884 | 964 | 1016 | SM00209 | Thrombospondin | |
IPR000884 | 1019 | 1066 | SM00209 | Thrombospondin | |
ProfileScan | IPR001627 | 154 | 604 | PS51004 | Semaphorin/CD100 antigen |
IPR000884 | 715 | 771 | PS50092 | Thrombospondin | |
IPR000884 | 773 | 822 | PS50092 | Thrombospondin | |
IPR000884 | 904 | 959 | PS50092 | Thrombospondin | |
IPR000884 | 961 | 1016 | PS50092 | Thrombospondin | |
IPR000884 | 1017 | 1061 | PS50092 | Thrombospondin |
![]() |
Primer_f | TACTGGGAACTGGAGGCTGAC |
---|---|
Primer_r | AAGCAGGTCTCAGCCAACAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGAGGATCAATGCCATAGGAG |
Primer_r | AAGCAGGTCTCAGCCAACAAC |
PCR product length | 100 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |