KIAA1445

Product ID	ORK00840
Accession No	AB040878
Description	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B, transcript variant 1
Clone name	fg03469b
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4559 bp) Predicted protein sequence (1202 aa)
HaloTag ORF Clone	FHC00840
Flexi ORF Clone	FXC00840
Source	Human fetal brain
Rouge ID	mKIAA1445 by Kazusa Mouse cDNA Project

Length: 4559 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	950 bp
Genome contig ID	gi89161205r_124010730
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GTGGCATTATTAATTAAAGATGATATCCAGTCTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGTCTCTGTGCATCTGTGCGTGGGCTCCTCTTGCATAGTCTAGGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	124110730	124229115	23	99.6	Perfect prediction

Length: 1202 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAH12129	98.9	unnamed protein...	Homo sapiens
BAG10070	100.0	semaphorin-5B p...	synthetic construct
AAH77726	99.9	Sema domain, se...	Homo sapiens
Q9P283	99.7	Semaphorin-5B.	Homo sapiens
EAW79458	99.7	sema domain, se...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040912	7.6e-39	35.8	KIAA1479
AB037789	1.2e-36	34.2	KIAA1368
AB058772	9.9e-36	36.2	KIAA1869
AB051526	1.3e-25	31.7	KIAA1739
AB051532	1.5e-20	33.1	KIAA1745

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008085	905	918	PR01705	Thrombospondin
	IPR008085	923	934	PR01705	Thrombospondin
	IPR008085	942	953	PR01705	Thrombospondin
HMMPfam	IPR001627	177	588	PF01403	Semaphorin/CD100 antigen
	IPR002165	606	653	PF01437	Plexin
	IPR000884	719	770	PF00090	Thrombospondin
	IPR000884	777	821	PF00090	Thrombospondin
	IPR000884	908	958	PF00090	Thrombospondin
	IPR000884	965	1015	PF00090	Thrombospondin
	IPR000884	1020	1060	PF00090	Thrombospondin
HMMSmart	IPR001627	177	588	SM00630	Semaphorin/CD100 antigen
	IPR003659	606	653	SM00423	Plexin/semaphorin/integrin
	IPR000884	718	771	SM00209	Thrombospondin
	IPR000884	776	822	SM00209	Thrombospondin
	IPR000884	907	959	SM00209	Thrombospondin
	IPR000884	964	1016	SM00209	Thrombospondin
	IPR000884	1019	1066	SM00209	Thrombospondin
ProfileScan	IPR001627	154	604	PS51004	Semaphorin/CD100 antigen
	IPR000884	715	771	PS50092	Thrombospondin
	IPR000884	773	822	PS50092	Thrombospondin
	IPR000884	904	959	PS50092	Thrombospondin
	IPR000884	961	1016	PS50092	Thrombospondin
	IPR000884	1017	1061	PS50092	Thrombospondin

Primer_f	TACTGGGAACTGGAGGCTGAC
Primer_r	AAGCAGGTCTCAGCCAACAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGAGGATCAATGCCATAGGAG
Primer_r	AAGCAGGTCTCAGCCAACAAC
PCR product length	100 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles