Order Kazusa clone(s) from : ![]() |
Product ID | ORK06763 |
---|---|
Accession No | AB051526 |
Description | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C |
Clone name | pj00464 |
Vector information | |
cDNA sequence | DNA sequence (3776 bp) Predicted protein sequence (963 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1739
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 884 bp |
---|---|
Genome contig ID | gi89161199r_96789206 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 96889206 | 96896394 | 13 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 183 | 611 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 629 | 681 | PF01437 | Plexin | |
HMMSmart | IPR001627 | 183 | 611 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 629 | 681 | SM00423 | Plexin/semaphorin/integrin | |
IPR003599 | 692 | 776 | SM00409 | Immunoglobulin subtype | |
ProfileScan | IPR001627 | 160 | 627 | PS51004 | Semaphorin/CD100 antigen |
IPR007110 | 686 | 767 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | HSRLCLLLCWTLIEAVGSR | 43 | SECONDARY | 19 | 2 | 730 | PGSFLYDARLQALVVMAA | 747 | SECONDARY | 18 | 3 | 765 | RLAAEGYLVAVVAGPSVTLEAR | 786 | SECONDARY | 22 | 4 | 791 | NLGLVWLAVVALGAVCLVLLLLV | 813 | PRIMARY | 23 |
---|
![]() |
Primer_f | ATGCTGGCCTTCTTGTGGATG |
---|---|
Primer_r | CACACTCTCAGGTACATAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |