Order Kazusa clone(s) from : ![]() |
Product ID | ORK06762 |
---|---|
Accession No | AB051532 |
Description | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B |
Clone name | pj01678 |
Vector information | |
cDNA sequence | DNA sequence (3766 bp) Predicted protein sequence (893 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1745
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1015 bp |
---|---|
Genome contig ID | gi51511731f_88445578 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (128318 - 128367) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 88545578 | 88573894 | 14 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 126 | 563 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 581 | 633 | PF01437 | Plexin | |
HMMSmart | IPR001627 | 126 | 563 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 581 | 635 | SM00423 | Plexin/semaphorin/integrin | |
ProfileScan | IPR001627 | 103 | 579 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 772 | KEFLVMCTLFVLAVLLPVLFLLY | 794 | PRIMARY | 23 |
---|
![]() |
Primer_f | CAATGTACGCCTTTCCCTCAG |
---|---|
Primer_r | GCAGTTAGTTCCTCGTGTTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |