KIAA0331

Product ID	ORK00507
Accession No	AB002329
Description	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E, transcript variant 1
Clone name	hg00928
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hg00928 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6474 bp) Predicted protein sequence (814 aa)
HaloTag ORF Clone	FHC00507
Flexi ORF Clone	FXC00507
Source	Human adult brain
Rouge ID	mKIAA0331 by Kazusa Mouse cDNA Project

Length: 6474 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3680 bp
Genome contig ID	gi89161213r_82731446
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTCCGGCCTGGGCGACAGAGCGAGACTCCGTCTC
Flanking genome sequence (99712 - 99663)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	82831158	83116260	17	99.2	Perfect prediction

Length: 814 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15041	100.0	Semaphorin-3E; ...	Homo sapiens
XP_527803	99.9	semaphorin 3E [...	Pan troglodytes
AAI44339	99.9	Sema domain, im...	Homo sapiens
BAG59693	98.6	unnamed protein...	Homo sapiens
BAG64853	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051526	2.8e-55	33.8	KIAA1739
AB040912	1.1e-49	34.2	KIAA1479
AB051532	2.8e-47	30.6	KIAA1745
AB046839	1.8e-44	31.6	KIAA1619
AB037789	1.1e-40	31.8	KIAA1368

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	97	539	PF01403	Semaphorin/CD100 antigen
HMMPfam	IPR013151	634	695	PF00047	Immunoglobulin
HMMSmart	IPR001627	97	539	SM00630	Semaphorin/CD100 antigen
HMMSmart	IPR003659	557	612	SM00423	Plexin/semaphorin/integrin
ProfileScan	IPR001627	71	555	PS51004	Semaphorin/CD100 antigen
ProfileScan	IPR007110	633	708	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	39	SMASAGHIITLLLWGYLLELWTG	61	PRIMARY	23

Primer_f	GCGCTCTAGACAGGACATGGC
Primer_r	GACAGTTGTTTATAAGCCGGG
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTTGTGAGAAATGCCCAGGC
Primer_r	TTGGTGAGATGAAGGGTGAAC
PCR product length	126 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles