Order Kazusa clone(s) from : ![]() |
Product ID | ORK00847 |
---|---|
Accession No | AB040912 |
Description | sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D, transcript variant 1 |
Clone name | fh17949 |
Vector information | |
cDNA sequence | DNA sequence (5924 bp) Predicted protein sequence (1022 aa) |
HaloTag ORF Clone |
FHC00847
![]() |
Flexi ORF Clone | FXC00847 |
Source | Human fetal brain |
Rouge ID |
mKIAA1479
by Kazusa Mouse cDNA Project
|
Note | We replaced fj05577, former representative clones for KIAA1479 with fh17949. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2437 bp |
---|---|
Genome contig ID | gi51511731f_45163695 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (690016 - 690065) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 45263695 | 45853709 | 18 | 99.4 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 70 | 507 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 525 | 593 | PF01437 | Plexin | |
HMMSmart | IPR001627 | 68 | 498 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 525 | 593 | SM00423 | Plexin/semaphorin/integrin | |
ProfileScan | IPR001627 | 38 | 523 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 11 | TMRVFLLCAYILLLMVSQLRAVS | 33 | PRIMARY | 23 | 2 | 612 | VLITCVFAAFVLGAFIAGVAVYC | 634 | PRIMARY | 23 |
---|
![]() |
Primer_f | AGTTAATATGCTGCACACCAC |
---|---|
Primer_r | CTGGTCTTCTGCAACATGTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |