Order Kazusa clone(s) from : ![]() |
Product ID | ORK00937 |
---|---|
Accession No | AB058772 |
Description | sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C, transcript variant 2 |
Clone name | hh01800 |
Vector information | |
cDNA sequence | DNA sequence (5261 bp) Predicted protein sequence (935 aa) |
HaloTag ORF Clone |
FHC00937
![]() |
Flexi ORF Clone | FXC00937 |
Source | Human adult brain |
Rouge ID |
mKIAA1869
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 776 bp |
---|---|
Genome contig ID | gi89161185r_149270808 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 149370808 | 149385711 | 19 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 69 | 496 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 523 | 544 | PF01437 | Plexin | |
HMMSmart | IPR001627 | 66 | 494 | SM00630 | Semaphorin/CD100 antigen |
ProfileScan | IPR001627 | 35 | 521 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 7 | PRAPHFMPLLLLLLLLSLPHTQ | 28 | SECONDARY | 22 | 2 | 610 | LLLASVAAAFALGASVSGLLVSC | 632 | PRIMARY | 23 |
---|
![]() |
Primer_f | TCGCTCTCTGCCTTCATCTGG |
---|---|
Primer_r | CACCGTTAATTCGCTCGTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCGCTCTCTGCCTTCATCTG |
Primer_r | CTTCCCCAGCCTCAACTAAAC |
PCR product length | 95 bp |
PCR conditions | 15 °C![]() ![]() ![]() ![]() |