Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01075 |
---|---|
Accession No | AB002364 |
Description | ADAM metallopeptidase with thrombospondin type 1 motif, 3 |
Clone name | hh00124 |
Vector information | |
cDNA sequence | DNA sequence (5774 bp) Predicted protein sequence (1201 aa) |
HaloTag ORF Clone |
FHC01075
|
Flexi ORF Clone | FXC01075 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013273 | 556 | 574 | PR01857 | Peptidase M12B |
IPR013273 | 669 | 688 | PR01857 | Peptidase M12B | |
IPR013273 | 689 | 708 | PR01857 | Peptidase M12B | |
HMMPfam | IPR002870 | 3 | 197 | PF01562 | Peptidase M12B |
IPR001590 | 254 | 456 | PF01421 | Peptidase M12B | |
IPR000884 | 551 | 601 | PF00090 | Thrombospondin | |
IPR010294 | 709 | 823 | PF05986 | ADAM-TS Spacer 1 | |
IPR000884 | 843 | 900 | PF00090 | Thrombospondin | |
IPR000884 | 905 | 962 | PF00090 | Thrombospondin | |
IPR000884 | 966 | 1011 | PF00090 | Thrombospondin | |
HMMSmart | IPR000884 | 550 | 602 | SM00209 | Thrombospondin |
IPR000884 | 844 | 901 | SM00209 | Thrombospondin | |
IPR000884 | 904 | 963 | SM00209 | Thrombospondin | |
IPR000884 | 965 | 1012 | SM00209 | Thrombospondin | |
ProfileScan | IPR001590 | 252 | 456 | PS50215 | Peptidase M12B |
IPR000884 | 547 | 602 | PS50092 | Thrombospondin | |
IPR000884 | 841 | 901 | PS50092 | Thrombospondin | |
IPR000884 | 902 | 961 | PS50092 | Thrombospondin | |
IPR000884 | 962 | 1012 | PS50092 | Thrombospondin | |
IPR010909 | 1007 | 1050 | PS50900 | PLAC |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 291 | ESLGVHINVVLVRMIMLGYAKSI | 313 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | TTTATTGGTACGTGCTCTCAG |
---|---|
Primer_r | GGAAGATAAAGATGGTCACAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTATTGGTACGTGCTCTCAG |
Primer_r | GGAAGATAAAGATGGTCACAC |
PCR product length | 159 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |