Order Kazusa clone(s) from : ![]() |
Product ID | ORK00218 |
---|---|
Accession No | AB037767 |
Description | ADAM metallopeptidase with thrombospondin type 1 motif, 1 |
Clone name | fj00671 |
Vector information | |
cDNA sequence | DNA sequence (4309 bp) Predicted protein sequence (999 aa) |
HaloTag ORF Clone |
FHC00218
![]() |
Flexi ORF Clone | FXC00218 |
Source | Human fetal brain |
Rouge ID |
mKIAA1346
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1290 bp |
---|---|
Genome contig ID | gi51511750r_27030479 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 21 | r | 27130479 | 27139259 | 9 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013274 | 33 | 51 | PR01858 | Peptidase M12B |
IPR013274 | 134 | 145 | PR01858 | Peptidase M12B | |
IPR013274 | 196 | 208 | PR01858 | Peptidase M12B | |
IPR013274 | 226 | 240 | PR01858 | Peptidase M12B | |
IPR013274 | 345 | 356 | PR01858 | Peptidase M12B | |
IPR013273 | 600 | 618 | PR01857 | Peptidase M12B | |
IPR013274 | 646 | 655 | PR01858 | Peptidase M12B | |
IPR013273 | 717 | 736 | PR01857 | Peptidase M12B | |
IPR013273 | 737 | 756 | PR01857 | Peptidase M12B | |
IPR013274 | 959 | 975 | PR01858 | Peptidase M12B | |
HMMPfam | IPR002870 | 66 | 205 | PF01562 | Peptidase M12B |
IPR001590 | 290 | 499 | PF01421 | Peptidase M12B | |
IPR000884 | 595 | 645 | PF00090 | Thrombospondin | |
IPR010294 | 757 | 875 | PF05986 | ADAM-TS Spacer 1 | |
IPR000884 | 888 | 941 | PF00090 | Thrombospondin | |
IPR000884 | 947 | 998 | PF00090 | Thrombospondin | |
HMMSmart | IPR006586 | 500 | 580 | SM00608 | ADAM |
IPR000884 | 594 | 646 | SM00209 | Thrombospondin | |
IPR000884 | 889 | 942 | SM00209 | Thrombospondin | |
IPR000884 | 943 | 999 | SM00209 | Thrombospondin | |
ProfileScan | IPR001590 | 290 | 499 | PS50215 | Peptidase M12B |
IPR000884 | 591 | 646 | PS50092 | Thrombospondin | |
IPR000884 | 886 | 937 | PS50092 | Thrombospondin | |
IPR000884 | 940 | 999 | PS50092 | Thrombospondin | |
ScanRegExp | IPR006025 | 430 | 439 | PS00142 | Peptidase M |
IPR001128 | 524 | 533 | PS00086 | Cytochrome P450 |
![]() |
Primer_f | CCCTGTTTCCTGGTACTTATC |
---|---|
Primer_r | CCATAGCAGCCATAAACAGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |