KIAA0688

Product ID	ORK00605
Accession No	AB014588
Description	ADAM metallopeptidase with thrombospondin type 1 motif, 4
Clone name	hk03410
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4301 bp) Predicted protein sequence (849 aa)
HaloTag ORF Clone	FHC00605
Flexi ORF Clone	FXC00605
Source	Human adult brain
Rouge ID	mKIAA0688 by Kazusa Mouse cDNA Project

Length: 4301 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1387 bp
Genome contig ID	gi89161185r_159326262
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGATTAAATAATGTAAATAAAGAACTAGCATAAC
Flanking genome sequence (99905 - 99856)	----+--------+--------+--------+--------+----* ACTCAGCATCTAGTAAGTGCTCAACAAATAGCAGCTGCTGTTACTTACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	159426167	159435441	9	99.3	Perfect prediction

Length: 849 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09812	100.0	ADAM metallopep...	synthetic construct
O75173	99.9	A disintegrin a...	Homo sapiens
CAH72146	99.8	ADAM metallopep...	Homo sapiens
BAF84262	99.8	unnamed protein...	Homo sapiens
AAQ89245	99.8	ADAMTS4 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037767	4.7e-131	50.1	KIAA1346
AB037733	2.4e-95	46.0	KIAA1312
AB002364	8.3e-53	31.8	KIAA0366
AB095949	3.2e-37	35.6	KIAA2029
AB011177	2.3e-22	33.9	KIAA0605

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	541	559	PR01857	Peptidase M12B
	IPR013273	658	677	PR01857	Peptidase M12B
	IPR013273	678	697	PR01857	Peptidase M12B
HMMPfam	IPR002870	48	154	PF01562	Peptidase M12B
	IPR001590	230	440	PF01421	Peptidase M12B
	IPR000884	536	586	PF00090	Thrombospondin
	IPR010294	698	815	PF05986	ADAM-TS Spacer 1
HMMSmart	IPR006586	453	521	SM00608	ADAM
HMMSmart	IPR000884	535	587	SM00209	Thrombospondin
ProfileScan	IPR001590	230	440	PS50215	Peptidase M12B
ProfileScan	IPR000884	532	587	PS50092	Thrombospondin
ScanRegExp	IPR006025	370	379	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	31	GAQPCLLLPIVPLSWLVWLLLLL	53	PRIMARY	23

Primer_f	ACCTGTTCTGCTTTCCTCTTC
Primer_r	AAGATAATCCCTCACTCCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACCTGTTCTGCTTTCCTCTTC
Primer_r	AAGATAATCCCTCACTCCCTG
PCR product length	91 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles