Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07113 |
---|---|
Accession No | AB023177 |
Description | thrombospondin, type I, domain containing 7A |
Clone name | hj05779s1 |
Vector information | |
cDNA sequence | DNA sequence (5669 bp) Predicted protein sequence (1502 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0960
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05779, former representative clones for KIAA0960 with hj05779s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1159 bp |
---|---|
Genome contig ID | gi89161213r_11280787 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 11380787 | 11642839 | 26 | 99.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000884 | 43 | 91 | PF00090 | Thrombospondin |
IPR000884 | 209 | 237 | PF00090 | Thrombospondin | |
IPR000884 | 361 | 418 | PF00090 | Thrombospondin | |
IPR000884 | 483 | 539 | PF00090 | Thrombospondin | |
IPR000884 | 620 | 675 | PF00090 | Thrombospondin | |
IPR000884 | 755 | 803 | PF00090 | Thrombospondin | |
IPR000884 | 884 | 935 | PF00090 | Thrombospondin | |
IPR000884 | 944 | 1007 | PF00090 | Thrombospondin | |
IPR000884 | 1014 | 1064 | PF00090 | Thrombospondin | |
IPR000884 | 1135 | 1185 | PF00090 | Thrombospondin | |
IPR000884 | 1263 | 1319 | PF00090 | Thrombospondin | |
HMMSmart | IPR000884 | 42 | 92 | SM00209 | Thrombospondin |
IPR000884 | 208 | 268 | SM00209 | Thrombospondin | |
IPR000884 | 271 | 355 | SM00209 | Thrombospondin | |
IPR000884 | 360 | 419 | SM00209 | Thrombospondin | |
IPR000884 | 482 | 540 | SM00209 | Thrombospondin | |
IPR000884 | 543 | 614 | SM00209 | Thrombospondin | |
IPR000884 | 619 | 676 | SM00209 | Thrombospondin | |
IPR000884 | 754 | 804 | SM00209 | Thrombospondin | |
IPR000884 | 883 | 940 | SM00209 | Thrombospondin | |
IPR000884 | 943 | 1008 | SM00209 | Thrombospondin | |
IPR000884 | 1013 | 1065 | SM00209 | Thrombospondin | |
IPR000884 | 1068 | 1129 | SM00209 | Thrombospondin | |
IPR000884 | 1134 | 1186 | SM00209 | Thrombospondin | |
IPR000884 | 1187 | 1257 | SM00209 | Thrombospondin | |
IPR000884 | 1262 | 1320 | SM00209 | Thrombospondin | |
ProfileScan | IPR000884 | 39 | 92 | PS50092 | Thrombospondin |
IPR000884 | 205 | 261 | PS50092 | Thrombospondin | |
IPR000884 | 268 | 355 | PS50092 | Thrombospondin | |
IPR000884 | 357 | 419 | PS50092 | Thrombospondin | |
IPR000884 | 479 | 540 | PS50092 | Thrombospondin | |
IPR000884 | 541 | 614 | PS50092 | Thrombospondin | |
IPR000884 | 616 | 676 | PS50092 | Thrombospondin | |
IPR000884 | 751 | 804 | PS50092 | Thrombospondin | |
IPR000884 | 880 | 1065 | PS50092 | Thrombospondin | |
IPR000884 | 1131 | 1186 | PS50092 | Thrombospondin | |
IPR000884 | 1259 | 1320 | PS50092 | Thrombospondin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1452 | WVYGVAAGAFVLLIFIVSMIYLA | 1474 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CACTTCCTCATCACTGCAGCC |
---|---|
Primer_r | AACCAACTAGAGGAATCCACC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACTTCCTCATCACTGCAGCC |
Primer_r | AACCAACTAGAGGAATCCACC |
PCR product length | 108 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |