KIAA0960

Product ID	ORK07113
Accession No	AB023177
Description	thrombospondin, type I, domain containing 7A
Clone name	hj05779s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5669 bp) Predicted protein sequence (1502 aa)
Source	Human adult brain
Rouge ID	mKIAA0960 by Kazusa Mouse cDNA Project
Note	We replaced hj05779, former representative clones for KIAA0960 with hj05779s1. (2002/5/10)

Length: 5669 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1159 bp
Genome contig ID	gi89161213r_11280787
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGACTAGATTTTTATATTTGTTATCTTTGTTAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAGGAACTGGATGTCTTTTTAATTTTGAGCAGATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	11380787	11642839	26	99.9	Perfect prediction

Length: 1502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPZ6	100.0	Thrombospondin ...	Homo sapiens
NP_056019	99.9	thrombospondin,...	Homo sapiens
EAW93637	98.2	hCG17390 [Homo ...	Homo sapiens
XP_001915637	94.1	similar to Thro...	Equus caballus
XP_001787380	92.6	similar to Thro...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051466	0	51.0	KIAA1679
AB037733	1.5e-12	22.4	KIAA1312
AB011177	4.8e-11	27.4	KIAA0605
AB018305	8.4e-10	27.0	KIAA0762
AB002364	1.2e-08	24.1	KIAA0366

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000884	43	91	PF00090	Thrombospondin
	IPR000884	209	237	PF00090	Thrombospondin
	IPR000884	361	418	PF00090	Thrombospondin
	IPR000884	483	539	PF00090	Thrombospondin
	IPR000884	620	675	PF00090	Thrombospondin
	IPR000884	755	803	PF00090	Thrombospondin
	IPR000884	884	935	PF00090	Thrombospondin
	IPR000884	944	1007	PF00090	Thrombospondin
	IPR000884	1014	1064	PF00090	Thrombospondin
	IPR000884	1135	1185	PF00090	Thrombospondin
	IPR000884	1263	1319	PF00090	Thrombospondin
HMMSmart	IPR000884	42	92	SM00209	Thrombospondin
	IPR000884	208	268	SM00209	Thrombospondin
	IPR000884	271	355	SM00209	Thrombospondin
	IPR000884	360	419	SM00209	Thrombospondin
	IPR000884	482	540	SM00209	Thrombospondin
	IPR000884	543	614	SM00209	Thrombospondin
	IPR000884	619	676	SM00209	Thrombospondin
	IPR000884	754	804	SM00209	Thrombospondin
	IPR000884	883	940	SM00209	Thrombospondin
	IPR000884	943	1008	SM00209	Thrombospondin
	IPR000884	1013	1065	SM00209	Thrombospondin
	IPR000884	1068	1129	SM00209	Thrombospondin
	IPR000884	1134	1186	SM00209	Thrombospondin
	IPR000884	1187	1257	SM00209	Thrombospondin
	IPR000884	1262	1320	SM00209	Thrombospondin
ProfileScan	IPR000884	39	92	PS50092	Thrombospondin
	IPR000884	205	261	PS50092	Thrombospondin
	IPR000884	268	355	PS50092	Thrombospondin
	IPR000884	357	419	PS50092	Thrombospondin
	IPR000884	479	540	PS50092	Thrombospondin
	IPR000884	541	614	PS50092	Thrombospondin
	IPR000884	616	676	PS50092	Thrombospondin
	IPR000884	751	804	PS50092	Thrombospondin
	IPR000884	880	1065	PS50092	Thrombospondin
	IPR000884	1131	1186	PS50092	Thrombospondin
	IPR000884	1259	1320	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1452	WVYGVAAGAFVLLIFIVSMIYLA	1474	PRIMARY	23

Primer_f	CACTTCCTCATCACTGCAGCC
Primer_r	AACCAACTAGAGGAATCCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CACTTCCTCATCACTGCAGCC
Primer_r	AACCAACTAGAGGAATCCACC
PCR product length	108 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles