KIAA1679

Product ID	ORK07114
Accession No	AB051466
Description	thrombospondin, type I, domain containing 7B
Clone name	fh22954
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5724 bp) Predicted protein sequence (1536 aa)
Source	Human fetal brain
Rouge ID	mKIAA1679 by Kazusa Mouse cDNA Project

Length: 5724 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1112 bp
Genome contig ID	gi89161199f_137430536
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTATTTATAACAAATAAACTGCTCAAGAGACTGC
Flanking genome sequence (721223 - 721272)	----+--------+--------+--------+--------+----* AGTGTTGGCTGTTCTAGATTTATTCACTTCTGAAGTGCCTTGCCCTTGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	137530536	138151757	26	99.9	Perfect prediction

Length: 1536 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073896	99.9	thrombospondin,...	Homo sapiens
Q9C0I4	99.9	Thrombospondin ...	Homo sapiens
XP_001490296	89.5	similar to Thro...	Equus caballus
XP_222597	85.8	similar to ADAM...	Rattus norvegicus
Q6P4U0	85.8	Thrombospondin ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023177	0	51.0	KIAA0960
AB040878	2.8e-11	27.2	KIAA1445
AB018305	5.1e-09	30.4	KIAA0762
AB011177	3.9e-08	28.9	KIAA0605
AB011122	8.5e-07	25.2	KIAA0550

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000884	111	160	PF00090	Thrombospondin
	IPR000884	268	316	PF00090	Thrombospondin
	IPR000884	533	588	PF00090	Thrombospondin
	IPR000884	669	723	PF00090	Thrombospondin
	IPR000884	803	851	PF00090	Thrombospondin
	IPR000884	932	983	PF00090	Thrombospondin
	IPR000884	1061	1110	PF00090	Thrombospondin
	IPR000884	1181	1231	PF00090	Thrombospondin
	IPR000884	1304	1360	PF00090	Thrombospondin
HMMSmart	IPR000884	110	161	SM00209	Thrombospondin
	IPR000884	267	327	SM00209	Thrombospondin
	IPR000884	415	471	SM00209	Thrombospondin
	IPR000884	532	589	SM00209	Thrombospondin
	IPR000884	592	663	SM00209	Thrombospondin
	IPR000884	668	724	SM00209	Thrombospondin
	IPR000884	802	850	SM00209	Thrombospondin
	IPR000884	856	926	SM00209	Thrombospondin
	IPR000884	931	988	SM00209	Thrombospondin
	IPR000884	991	1055	SM00209	Thrombospondin
	IPR000884	1060	1111	SM00209	Thrombospondin
	IPR000884	1114	1175	SM00209	Thrombospondin
	IPR000884	1180	1232	SM00209	Thrombospondin
	IPR000884	1233	1298	SM00209	Thrombospondin
	IPR000884	1303	1361	SM00209	Thrombospondin
ProfileScan	IPR000884	107	161	PS50092	Thrombospondin
	IPR000884	264	320	PS50092	Thrombospondin
	IPR000884	327	410	PS50092	Thrombospondin
	IPR000884	412	471	PS50092	Thrombospondin
	IPR000884	529	589	PS50092	Thrombospondin
	IPR000884	590	663	PS50092	Thrombospondin
	IPR000884	665	724	PS50092	Thrombospondin
	IPR000884	799	852	PS50092	Thrombospondin
	IPR000884	928	1055	PS50092	Thrombospondin
	IPR000884	1057	1111	PS50092	Thrombospondin
	IPR000884	1177	1232	PS50092	Thrombospondin
	IPR000884	1300	1361	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1486	IWVYGVSGGAFLIMIFLIFTSYL	1508	PRIMARY	23

Primer_f	CATGCCAGCTGAGTGAAAACG
Primer_r	GAGAGCTGACAGTTGACCACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CATGCCAGCTGAGTGAAAACG
Primer_r	GAGAGCTGACAGTTGACCACG
PCR product length	178(2.0k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles