Gene/Protein Characteristic Table for FLJ00110
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06067
Accession No AK024501
Clone name as00110
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4229 bp)
Predicted protein sequence (224 aa)
Source Human spleen
Rouge ID mFLJ00110 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4229 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 224 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15791 1.1e-85 100.0 FLJ00110 protei...
Homo sapiens
EAW82532 6.5e-64 100.0 MAX dimerizatio...
Homo sapiens
XP_517071 3.2e-50 100.0 MAD4 isoform 2 ...
Pan troglodytes
Q14582 3.2e-50 100.0 Max-interacting...
Homo sapiens
AAV38770 3.2e-50 100.0 MAX dimerizatio...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001092 80 121 PF00010 Basic helix-loop-helix dimerization domain bHLH
HMMSmart IPR001092 74 126 SM00353 Basic helix-loop-helix dimerization domain bHLH
ProfileScan NULL 78 118 PS50037 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCCTGATGGTTCTGTCTCTG
Primer_r AGTTTCTTGATGTGCACCTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp