KIAA0856

Product ID	ORK04796
Accession No	AB020663
Description	Dmx-like 2
Clone name	bf00171
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7912 bp) Predicted protein sequence (2237 aa)
Source	Human adult brain
Rouge ID	mKIAA0856 by Kazusa Mouse cDNA Project
Note	We replaced hk06221, former representative clones for KIAA0856 with bf00171. (2002/5/10)

Length: 7912 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1196 bp
Genome contig ID	gi51511731r_49427277
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGTAAAAGAAAAATAAATGTTATTTGTTAGAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTAGTTTGATACTGTTTTTGACCATTGAGATTTTTAATTTGATAAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	49527277	49615189	31	99.7	Perfect prediction

Length: 2237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44540	100.0	DMXL2 protein [...	Homo sapiens
EAW77422	99.9	Dmx-like 2, iso...	Homo sapiens
Q8TDJ6	99.8	DmX-like protei...	Homo sapiens
XP_510406	99.7	Dmx-like 2 [Pan...	Pan troglodytes
XP_535481	95.9	similar to Dmx-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020700	0.00063	23.7	KIAA0893

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	202	228	PF00400	WD40 repeat
	IPR001680	2091	2129	PF00400	WD40 repeat
	IPR001680	2133	2171	PF00400	WD40 repeat
HMMSmart	IPR001680	187	228	SM00320	WD40 repeat
	IPR001680	435	472	SM00320	WD40 repeat
	IPR001680	1957	1992	SM00320	WD40 repeat
	IPR001680	1996	2035	SM00320	WD40 repeat
	IPR001680	2042	2084	SM00320	WD40 repeat
	IPR001680	2090	2129	SM00320	WD40 repeat
	IPR001680	2132	2171	SM00320	WD40 repeat
	IPR001680	2184	2222	SM00320	WD40 repeat
ProfileScan	IPR001680	1960	2180	PS50294	WD40 repeat
	IPR001680	2097	2138	PS50082	WD40 repeat
	IPR001680	2139	2180	PS50082	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1542	NILLCEAVVAVYLSLLIHALATN	1564	PRIMARY	23

Primer_f	GGCCAGTTAATAGTTGATGAG
Primer_r	CCACACAGGCATTGAACATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-