Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04796 |
---|---|
Accession No | AB020663 |
Description | Dmx-like 2 |
Clone name | bf00171 |
Vector information | |
cDNA sequence | DNA sequence (7912 bp) Predicted protein sequence (2237 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0856
by Kazusa Mouse cDNA Project
|
Note | We replaced hk06221, former representative clones for KIAA0856 with bf00171. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1196 bp |
---|---|
Genome contig ID | gi51511731r_49427277 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 49527277 | 49615189 | 31 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 202 | 228 | PF00400 | WD40 repeat |
IPR001680 | 2091 | 2129 | PF00400 | WD40 repeat | |
IPR001680 | 2133 | 2171 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 187 | 228 | SM00320 | WD40 repeat |
IPR001680 | 435 | 472 | SM00320 | WD40 repeat | |
IPR001680 | 1957 | 1992 | SM00320 | WD40 repeat | |
IPR001680 | 1996 | 2035 | SM00320 | WD40 repeat | |
IPR001680 | 2042 | 2084 | SM00320 | WD40 repeat | |
IPR001680 | 2090 | 2129 | SM00320 | WD40 repeat | |
IPR001680 | 2132 | 2171 | SM00320 | WD40 repeat | |
IPR001680 | 2184 | 2222 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 1960 | 2180 | PS50294 | WD40 repeat |
IPR001680 | 2097 | 2138 | PS50082 | WD40 repeat | |
IPR001680 | 2139 | 2180 | PS50082 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1542 | NILLCEAVVAVYLSLLIHALATN | 1564 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GGCCAGTTAATAGTTGATGAG |
---|---|
Primer_r | CCACACAGGCATTGAACATTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |