KIAA0893

Product ID	ORK00676
Accession No	AB020700
Description	WD repeat domain 47, transcript variant 3
Clone name	hk08702
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4195 bp) Predicted protein sequence (974 aa)
HaloTag ORF Clone	FHC00676
Flexi ORF Clone	FXC00676
Source	Human adult brain
Rouge ID	mKIAA0893 by Kazusa Mouse cDNA Project

Length: 4195 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1212 bp
Genome contig ID	gi89161185r_109214363
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTGCTATTATTTCAATAAAGACCTCTTGACATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTGTTTCTGTTCCTCAGTCTTTGGCTTTCAAAATAATGTTATTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	109314363	109386220	15	99.6	Perfect prediction

Length: 974 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94967	100.0	WD repeat-conta...	Homo sapiens
CAH71326	99.9	WD repeat domai...	Homo sapiens
AAH34964	99.7	WD repeat domai...	Homo sapiens
XP_513613	99.1	WD repeat domai...	Pan troglodytes
NP_001136022	99.1	WD repeat domai...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011168	0.00018	26.1	KIAA0596
AB033068	0.00028	24.1	KIAA1242
AB040882	0.00054	23.1	KIAA1449

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	715	742	PD000018	WD40 repeat
BlastProDom	IPR001680	806	838	PD000018	WD40 repeat
FPrintScan	IPR001680	824	838	PR00320	WD40 repeat
	IPR001680	912	926	PR00320	WD40 repeat
	IPR001680	958	972	PR00320	WD40 repeat
HMMPfam	IPR001680	652	689	PF00400	WD40 repeat
	IPR001680	706	744	PF00400	WD40 repeat
	IPR001680	800	837	PF00400	WD40 repeat
	IPR001680	845	883	PF00400	WD40 repeat
	IPR001680	887	925	PF00400	WD40 repeat
	IPR001680	933	971	PF00400	WD40 repeat
HMMSmart	IPR006594	65	97	SM00667	LisH dimerisation motif
	IPR006595	100	157	SM00668	CTLH
	IPR001680	651	689	SM00320	WD40 repeat
	IPR001680	702	744	SM00320	WD40 repeat
	IPR001680	752	796	SM00320	WD40 repeat
	IPR001680	799	837	SM00320	WD40 repeat
	IPR001680	844	883	SM00320	WD40 repeat
	IPR001680	886	925	SM00320	WD40 repeat
	IPR001680	932	971	SM00320	WD40 repeat
ProfileScan	IPR006594	65	97	PS50896	LisH dimerisation motif
	IPR006595	100	157	PS50897	CTLH
	IPR001680	712	742	PS50082	WD40 repeat
	IPR001680	712	974	PS50294	WD40 repeat
	IPR001680	806	846	PS50082	WD40 repeat
	IPR001680	851	892	PS50082	WD40 repeat
	IPR001680	893	927	PS50082	WD40 repeat
	IPR001680	939	974	PS50082	WD40 repeat
ScanRegExp	IPR001680	824	838	PS00678	WD40 repeat

Primer_f	AGCAGAGCAGCAGCAGTTATG
Primer_r	GCAGACATAGCATTTCAAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-