KIAA0596

Product ID	ORK01981
Accession No	AB011168
Description	mitogen-activated protein kinase binding protein 1, transcript variant 1
Clone name	hg01605
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7161 bp) Predicted protein sequence (1531 aa)
HaloTag ORF Clone	FHC01981
Flexi ORF Clone	FXC01981
Source	Human adult brain
Rouge ID	mKIAA0596 by Kazusa Mouse cDNA Project
Note	We replaced hj02942, former representative clones for KIAA0596 with hg01605. (2002/5/10)

Length: 7161 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2420 bp
Genome contig ID	gi51511731f_39754014
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGTATGAACTTGTCAATAAACACAATTGTTTGTT
Flanking genome sequence (153331 - 153380)	----+--------+--------+--------+--------+----* AACCCTGGGATGCCGGCCAGTGGGGCAGGCCGAAGCGGGCGCTGCCAGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	39854014	39907343	31	99.4	Perfect prediction

Length: 1531 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72639	100.0	mitogen-activat...	synthetic construct
O60336	99.9	Mitogen-activat...	Homo sapiens
NP_055809	99.5	mitogen-activat...	Homo sapiens
EAW92519	99.5	mitogen activat...	Homo sapiens
XP_544635	91.0	similar to mito...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	97	125	PF00400	WD40 repeat
	IPR001680	141	170	PF00400	WD40 repeat
	IPR001680	184	221	PF00400	WD40 repeat
	IPR001680	302	323	PF00400	WD40 repeat
	IPR001680	366	389	PF00400	WD40 repeat
	IPR001680	397	444	PF00400	WD40 repeat
	IPR001680	486	524	PF00400	WD40 repeat
	IPR001680	528	569	PF00400	WD40 repeat
	IPR001680	574	614	PF00400	WD40 repeat
	IPR001680	668	706	PF00400	WD40 repeat
	IPR001680	710	748	PF00400	WD40 repeat
HMMSmart	IPR001680	96	137	SM00320	WD40 repeat
	IPR001680	140	181	SM00320	WD40 repeat
	IPR001680	184	221	SM00320	WD40 repeat
	IPR001680	285	323	SM00320	WD40 repeat
	IPR001680	354	389	SM00320	WD40 repeat
	IPR001680	396	444	SM00320	WD40 repeat
	IPR001680	485	524	SM00320	WD40 repeat
	IPR001680	527	569	SM00320	WD40 repeat
	IPR001680	573	614	SM00320	WD40 repeat
	IPR001680	621	661	SM00320	WD40 repeat
	IPR001680	664	706	SM00320	WD40 repeat
	IPR001680	709	748	SM00320	WD40 repeat
ProfileScan	IPR001680	103	230	PS50294	WD40 repeat
	IPR001680	357	453	PS50294	WD40 repeat
	IPR001680	492	757	PS50294	WD40 repeat
	IPR001680	716	757	PS50082	WD40 repeat
ScanRegExp	IPR002114	878	893	PS00589	Phosphotransferase system

Primer_f	GTAGATGGGACAGGTAAGTGG
Primer_r	CAACTCTTCAACTGCCTCACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTAGATGGGACAGGTAAGTGG
Primer_r	CAACTCTTCAACTGCCTCACG
PCR product length	136 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles