KIAA1449

Product ID	ORK01167
Accession No	AB040882
Description	WD repeat domain 48, transcript variant 1
Clone name	fk04105
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3970 bp) Predicted protein sequence (680 aa)
HaloTag ORF Clone	FHC01167
Flexi ORF Clone	FXC01167
Source	Human fetal brain
Rouge ID	mKIAA1449 by Kazusa Mouse cDNA Project
Note	We replaced fh12395, former representative clones for KIAA1449 with fk04105. (2002/5/10)

Length: 3970 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1925 bp
Genome contig ID	gi89161205f_38968510
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GTTGTATAGAATAAAGGCTTTAGTTAAAATATTTC
Flanking genome sequence (144655 - 144704)	----+--------+--------+--------+--------+----* AAAGTGTAGTACACATTTATTTTCATTTGTTATTTTCTTTCATAGCAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	39068510	39113163	19	100.0	Perfect prediction

Length: 680 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516374	100.0	WD repeat domai...	Pan troglodytes
XP_001083670	100.0	similar to WD r...	Macaca mulatta
Q8TAF3	100.0	WD repeat-conta...	Homo sapiens
XP_001498347	99.9	WD repeat domai...	Equus caballus
Q5RAW8	99.9	WD repeat-conta...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007873	1.6e-07	25.3	KIAA0413
AB020700	2e-06	23.1	KIAA0893
AB014596	1.3e-05	27.9	KIAA0696
AB051495	6.6e-05	22.0	KIAA1708
AB037856	6.6e-05	22.8	KIAA1435

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	209	242	PD000018	WD40 repeat
FPrintScan	IPR001680	93	107	PR00320	WD40 repeat
	IPR001680	186	200	PR00320	WD40 repeat
	IPR001680	228	242	PR00320	WD40 repeat
HMMPfam	IPR001680	34	61	PF00400	WD40 repeat
	IPR001680	68	106	PF00400	WD40 repeat
	IPR001680	110	148	PF00400	WD40 repeat
	IPR001680	161	199	PF00400	WD40 repeat
	IPR001680	203	241	PF00400	WD40 repeat
	IPR001680	245	283	PF00400	WD40 repeat
HMMSmart	IPR001680	17	61	SM00320	WD40 repeat
	IPR001680	67	106	SM00320	WD40 repeat
	IPR001680	109	148	SM00320	WD40 repeat
	IPR001680	160	199	SM00320	WD40 repeat
	IPR001680	202	241	SM00320	WD40 repeat
	IPR001680	244	283	SM00320	WD40 repeat
	IPR001680	353	391	SM00320	WD40 repeat
ProfileScan	IPR001680	29	63	PS50082	WD40 repeat
	IPR001680	29	292	PS50294	WD40 repeat
	IPR001680	74	115	PS50082	WD40 repeat
	IPR001680	116	157	PS50082	WD40 repeat
	IPR001680	167	208	PS50082	WD40 repeat
	IPR001680	209	250	PS50082	WD40 repeat
ScanRegExp	IPR001680	93	107	PS00678	WD40 repeat
ScanRegExp	IPR001680	135	149	PS00678	WD40 repeat

Primer_f	TAACACTGTCACAACTTCTTC
Primer_r	TCTCTGTTTAATAGCAATGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-