KIAA1435

Product ID	ORK00833
Accession No	AB037856
Description	WD repeat and FYVE domain containing 1
Clone name	hh13841
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4574 bp) Predicted protein sequence (415 aa)
Flexi ORF Clone	FXC00833
Source	Human adult brain
Rouge ID	mKIAA1435 by Kazusa Mouse cDNA Project

Length: 4574 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3325 bp
Genome contig ID	gi89161199r_224348357
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGAAAATGTACACAATAAAACATTCCTTGCTTGTT
Flanking genome sequence (99953 - 99904)	----+--------+--------+--------+--------+----* ACTGTGTTTGCCTAATATCACTTTTGTTGTAGTCAGCCTGGACGTAGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	224448310	224518261	12	99.3	Perfect prediction

Length: 415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IWB7	1.8e-185	100.0	WD repeat and F...	Homo sapiens
XP_001166904	1e-184	99.5	hypothetical pr...	Pan troglodytes
Q2KIY3	6.4e-184	97.8	WD repeat and F...	Bos taurus
NP_001104749	2.2e-183	97.8	WD repeat and F...	Mus musculus
XP_001915602	4.7e-177	94.9	WD repeat and F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046863	9.8e-05	33.3	KIAA1643
AB033081	0.00019	26.5	KIAA1255
AB040882	0.00031	23.2	KIAA1449
AB023210	0.00048	25.6	KIAA0993
AB002369	0.00049	24.1	KIAA0371

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	199	233	PD000018	WD40 repeat
FPrintScan	IPR001680	44	58	PR00320	WD40 repeat
	IPR001680	219	233	PR00320	WD40 repeat
	IPR001680	386	400	PR00320	WD40 repeat
HMMPfam	IPR001680	19	57	PF00400	WD40 repeat
	IPR001680	109	143	PF00400	WD40 repeat
	IPR001680	194	232	PF00400	WD40 repeat
	IPR001680	237	275	PF00400	WD40 repeat
	IPR000306	284	358	PF01363	Zinc finger
	IPR001680	361	399	PF00400	WD40 repeat
HMMSmart	IPR001680	18	57	SM00320	WD40 repeat
	IPR001680	61	101	SM00320	WD40 repeat
	IPR001680	108	147	SM00320	WD40 repeat
	IPR001680	150	188	SM00320	WD40 repeat
	IPR001680	193	232	SM00320	WD40 repeat
	IPR001680	236	275	SM00320	WD40 repeat
	IPR000306	281	358	SM00064	Zinc finger
	IPR001680	360	399	SM00320	WD40 repeat
ProfileScan	IPR001680	25	56	PS50082	WD40 repeat
	IPR001680	25	284	PS50294	WD40 repeat
	IPR001680	200	233	PS50082	WD40 repeat
	IPR001680	243	284	PS50082	WD40 repeat
	IPR000306	286	357	PS50178	Zinc finger
ScanRegExp	IPR001680	219	233	PS00678	WD40 repeat
	IPR001680	262	276	PS00678	WD40 repeat
	IPR001680	386	400	PS00678	WD40 repeat

Primer_f	AAAGAAGTTAGTGACCCAGAG
Primer_r	ACAGGCTCCTCATTTCTTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-