Gene/Protein Characteristic Table for KIAA1255
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04104
Accession No AB033081
Description ankyrin repeat and FYVE domain containing 1
Clone name hh14633s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6457 bp)
Predicted protein sequence (1232 aa)
Source Human adult brain
Rouge ID mKIAA1255 by Kazusa Mouse cDNA Project
Note We replaced hh14633, former representative clones for KIAA1255 with hh14633s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 6457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2704 bp
Genome contig ID gi51511734r_3915117
PolyA signal sequence
(CATAAA,-19)		 
+----*----+----*----+----*----+----
TAACACCGAAATTTCCCATAAACTTAAGTGCCTAC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTTAGGACTTTTGAACTTTCAGTCATCTTTTTCGTGGTGTCTCACTGAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 r 4015117 4113891 25 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 1232 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG72458 0 100.0 ankyrin repeat ...
 synthetic construct
XP_001160123 0 99.3 ankyrin repeat ...
 Pan troglodytes
Q9P2R3 0 99.9 Ankyrin repeat ...
 Homo sapiens
AAI48356 0 99.8 Ankyrin repeat ...
 synthetic construct
XP_001160079 0 99.3 ankyrin repeat ...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033049 1.5e-10 27.2 KIAA1223
D86982 7e-06 31.1 KIAA0229
AB023174 1.5e-05 33.9 KIAA0957
AB014597 4.1e-05 24.1 KIAA0697
AB023210 6.7e-05 29.0 KIAA0993
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 554 566 PR01415 Ankyrin
IPR002110 618 630 PR01415 Ankyrin
HMMPfam IPR013069 121 225 PF00651 BTB/POZ
IPR002110 318 350 PF00023 Ankyrin
IPR002110 351 383 PF00023 Ankyrin
IPR002110 385 428 PF00023 Ankyrin
IPR002110 429 462 PF00023 Ankyrin
IPR002110 463 518 PF00023 Ankyrin
IPR002110 520 552 PF00023 Ankyrin
IPR002110 553 585 PF00023 Ankyrin
IPR002110 605 637 PF00023 Ankyrin
IPR002110 651 683 PF00023 Ankyrin
IPR002110 684 716 PF00023 Ankyrin
IPR002110 717 749 PF00023 Ankyrin
IPR002110 750 776 PF00023 Ankyrin
IPR002110 787 819 PF00023 Ankyrin
IPR002110 832 864 PF00023 Ankyrin
IPR002110 865 898 PF00023 Ankyrin
IPR002110 933 965 PF00023 Ankyrin
IPR002110 968 1000 PF00023 Ankyrin
IPR002110 1001 1033 PF00023 Ankyrin
IPR002110 1034 1067 PF00023 Ankyrin
IPR002110 1068 1105 PF00023 Ankyrin
IPR002110 1106 1138 PF00023 Ankyrin
IPR000306 1165 1228 PF01363 Zinc finger
HMMSmart IPR000210 131 225 SM00225 BTB/POZ-like
IPR002110 318 347 SM00248 Ankyrin
IPR002110 351 380 SM00248 Ankyrin
IPR002110 385 425 SM00248 Ankyrin
IPR002110 429 459 SM00248 Ankyrin
IPR002110 463 515 SM00248 Ankyrin
IPR002110 553 582 SM00248 Ankyrin
IPR002110 605 635 SM00248 Ankyrin
IPR002110 651 680 SM00248 Ankyrin
IPR002110 684 713 SM00248 Ankyrin
IPR002110 717 746 SM00248 Ankyrin
IPR002110 750 779 SM00248 Ankyrin
IPR002110 787 816 SM00248 Ankyrin
IPR002110 832 861 SM00248 Ankyrin
IPR002110 865 893 SM00248 Ankyrin
IPR002110 899 928 SM00248 Ankyrin
IPR002110 933 962 SM00248 Ankyrin
IPR002110 968 997 SM00248 Ankyrin
IPR002110 1001 1030 SM00248 Ankyrin
IPR002110 1034 1064 SM00248 Ankyrin
IPR002110 1068 1102 SM00248 Ankyrin
IPR002110 1106 1137 SM00248 Ankyrin
IPR000306 1162 1228 SM00064 Zinc finger
ProfileScan IPR000210 131 193 PS50097 BTB/POZ-like
IPR002110 280 1161 PS50297 Ankyrin
IPR002110 385 428 PS50088 Ankyrin
IPR002110 429 462 PS50088 Ankyrin
IPR002110 553 585 PS50088 Ankyrin
IPR002110 605 637 PS50088 Ankyrin
IPR002110 684 716 PS50088 Ankyrin
IPR002110 717 749 PS50088 Ankyrin
IPR002110 832 864 PS50088 Ankyrin
IPR002110 933 965 PS50088 Ankyrin
IPR002110 968 1000 PS50088 Ankyrin
IPR002110 1001 1033 PS50088 Ankyrin
IPR002110 1034 1055 PS50088 Ankyrin
IPR002110 1106 1138 PS50088 Ankyrin
IPR000306 1167 1227 PS50178 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCTGACTCCAACATGCCCTG
Primer_r GAAAACTTACAACAGCTAGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f AGCTGACTCCAACATGCCCTG
Primer_r GAAAACTTACAACAGCTAGGC
PCR product length 114 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp