KIAA0413

Product ID	ORK04119
Accession No	AB007873
Description	apoptotic peptidase activating factor 1, transcript variant 1
Clone name	hh00077s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1711) was subcloned upstream of the cDNA (1712-6574). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGAATTC ACTAGTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6574 bp) Predicted protein sequence (1237 aa)
Source	Human adult brain
Rouge ID	mKIAA0413 by Kazusa Mouse cDNA Project
Note	We replaced hh00077, former representative clones for KIAA0413 with hh00077s1. (2002/5/10)

Length: 6574 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2860 bp
Genome contig ID	gi89161190f_97466269
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTTTTGTAAAAATAAAATTCACAAAATTGTTTTG
Flanking genome sequence (187068 - 187117)	----+--------+--------+--------+--------+----* AAAAACATTTTTGGATTGTTTCATTCTTTGCTTGTCATTTATCTGTTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	97566269	97653335	26	99.5	Perfect prediction

Length: 1237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD38344	99.9	apoptotic prote...	Homo sapiens
EAW97610	99.7	apoptotic pepti...	Homo sapiens
XP_001151785	99.4	apoptotic prote...	Pan troglodytes
XP_001086945	97.2	apoptotic pepti...	Macaca mulatta
O14727	99.0	Apoptotic prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014596	1.3e-07	26.2	KIAA0696
AB040882	3.6e-07	25.3	KIAA1449
AB011168	9e-07	19.5	KIAA0596
D26488	0.00092	26.1	KIAA0007

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	643	674	PD000018	WD40 repeat
	IPR001680	727	760	PD000018	WD40 repeat
	IPR001680	867	898	PD000018	WD40 repeat
	IPR001680	991	1020	PD000018	WD40 repeat
FPrintScan	IPR000767	138	153	PR00364	Disease resistance protein
	IPR000767	221	235	PR00364	Disease resistance protein
	IPR000767	306	320	PR00364	Disease resistance protein
	IPR001680	705	719	PR00320	WD40 repeat
	IPR001680	747	761	PR00320	WD40 repeat
	IPR001680	1047	1061	PR00320	WD40 repeat
HMMPfam	IPR001315	6	90	PF00619	Caspase Recruitment
	IPR002182	98	403	PF00931	NB-ARC
	IPR001680	594	632	PF00400	WD40 repeat
	IPR001680	636	674	PF00400	WD40 repeat
	IPR001680	678	718	PF00400	WD40 repeat
	IPR001680	722	760	PF00400	WD40 repeat
	IPR001680	861	899	PF00400	WD40 repeat
	IPR001680	982	1020	PF00400	WD40 repeat
	IPR001680	1023	1060	PF00400	WD40 repeat
	IPR001680	1064	1102	PF00400	WD40 repeat
	IPR001680	1106	1144	PF00400	WD40 repeat
	IPR001680	1165	1192	PF00400	WD40 repeat
HMMSmart	IPR001680	593	632	SM00320	WD40 repeat
	IPR001680	635	674	SM00320	WD40 repeat
	IPR001680	677	718	SM00320	WD40 repeat
	IPR001680	721	760	SM00320	WD40 repeat
	IPR001680	776	814	SM00320	WD40 repeat
	IPR001680	817	857	SM00320	WD40 repeat
	IPR001680	860	899	SM00320	WD40 repeat
	IPR001680	941	978	SM00320	WD40 repeat
	IPR001680	982	1020	SM00320	WD40 repeat
	IPR001680	1022	1060	SM00320	WD40 repeat
	IPR001680	1063	1102	SM00320	WD40 repeat
	IPR001680	1105	1144	SM00320	WD40 repeat
	IPR001680	1156	1192	SM00320	WD40 repeat
ProfileScan	IPR001315	1	90	PS50209	Caspase Recruitment
	IPR001680	600	641	PS50082	WD40 repeat
	IPR001680	600	1237	PS50294	WD40 repeat
	IPR001680	642	683	PS50082	WD40 repeat
	IPR001680	684	727	PS50082	WD40 repeat
	IPR001680	728	769	PS50082	WD40 repeat
	IPR001680	867	899	PS50082	WD40 repeat
	IPR001680	988	1020	PS50082	WD40 repeat
	IPR001680	1029	1069	PS50082	WD40 repeat
	IPR001680	1070	1104	PS50082	WD40 repeat
	IPR001680	1112	1153	PS50082	WD40 repeat
ScanRegExp	IPR001680	661	675	PS00678	WD40 repeat
	IPR001680	705	719	PS00678	WD40 repeat
	IPR001680	747	761	PS00678	WD40 repeat
	IPR001680	1131	1145	PS00678	WD40 repeat

Primer_f	CTCATCTGCAAACTACAAAAC
Primer_r	CATGAAGAAAGAAGAGATACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTCATCTGCAAACTACAAAAC
Primer_r	CATGAAGAAAGAAGAGATACC
PCR product length	155 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles