KIAA1731

Gene/Protein Characteristic Table for KIAA1731

Order Kazusa clone(s) from :

Product ID	ORK05706
Accession No	AB051518
Description	centrosomal protein 295kDa
Clone name	bf02656
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7981 bp) Predicted protein sequence (2056 aa)
Source	Human adult brain
Rouge ID	mKIAA1731 by Kazusa Mouse cDNA Project
Note	We replaced ph00175, former representative clones for KIAA1731 with bf02656. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 7981 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1810 bp
Genome contig ID	gi51511727f_92934525
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAAATTATTTAAAGTCAATAAATTGTTATTCGAGG
Flanking genome sequence (168647 - 168696)	----+--------+--------+--------+--------+----* AATTCCATGTTGTGATTTCTTCCACTGTCCATCAAGGTCACTTTAGATCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	93034525	93103170	30	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 2056 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW66909	0	99.9	hCG2036584, iso...	Homo sapiens
EAW66908	0	99.9	hCG2036584, iso...	Homo sapiens
NP_203753	0	99.8	hypothetical pr...	Homo sapiens
EAW66907	0	99.2	hCG2036584, iso...	Homo sapiens
XP_343352	3.6e-183	60.6	hypothetical pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAGCAAAGTGGTGAGCATCTG
Primer_r	TCGGCTTATTGAGACTCGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 11

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp