KIAA1732

Product ID	ORK06787
Accession No	AB051519
Description	SET domain containing 2
Clone name	bg00050
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6403 bp) Predicted protein sequence (1915 aa)
Source	Human adult brain
Rouge ID	mKIAA1732 by Kazusa Mouse cDNA Project
Note	We replaced ph00196, former representative clones for KIAA1732 with bg00050. (2002/5/10)

Length: 6403 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	655 bp
Genome contig ID	gi89161205r_46932932
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GAACTTTTTATGTAAAAAAATAAAATCAATTAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTGGCATGTGTGTTCCCTAAAAGTTAATCAAGCATATTTGTGTGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	47032932	47139182	19	99.4	Perfect prediction

Length: 1915 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI17163	100.0	SET domain cont...	Homo sapiens
EAW64810	100.0	SET domain cont...	Homo sapiens
NP_054878	99.9	SET domain cont...	Homo sapiens
CAC28349	99.8	huntingtin inte...	Homo sapiens
Q9BYW2	99.8	Histone-lysine ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029013	7.2e-16	40.3	KIAA1090
AB002386	5.3e-05	31.6	KIAA0388
AB028999	0.00019	31.0	KIAA1076
AB002337	0.00076	32.8	KIAA0339
AB002302	0.00079	32.9	KIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001214	895	1024	PF00856	SET
	IPR001202	1742	1771	PF00397	WW/Rsp5/WWP
	IPR015119	1810	1906	PF09031	Set2-Rpb1 interacting
HMMSmart	IPR006560	845	900	SM00570	AWS
	IPR001214	901	1024	SM00317	SET
	IPR003616	1025	1041	SM00508	Post-SET zinc-binding region
	IPR001202	1741	1773	SM00456	WW/Rsp5/WWP
ProfileScan	IPR006560	845	899	PS51215	AWS
	IPR001214	900	1022	PS50280	SET
	IPR003616	1025	1041	PS50868	Post-SET zinc-binding region
	IPR001202	1740	1773	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	1746	1771	PS01159	WW/Rsp5/WWP

Primer_f	TAGTTGTGAGCTGTTGGCATG
Primer_r	ACAGATCATCAGGGTAAAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-