Order Kazusa clone(s) from : ![]() |
Product ID | ORK00967 |
---|---|
Accession No | AB082525 |
Description | TSC22 domain family, member 1, transcript variant 1 |
Clone name | bh00052 |
Vector information | |
cDNA sequence | DNA sequence (4815 bp) Predicted protein sequence (1117 aa) |
Flexi ORF Clone | FXC00967 |
Source | Human adult brain |
Rouge ID |
mKIAA1994
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1102 bp |
---|---|
Genome contig ID | gi51511729r_43805661 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | r | 43905661 | 44048701 | 3 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000580 | 1032 | 1087 | PD007152 | TSC-22 / Dip / Bun |
HMMPfam | IPR000580 | 1032 | 1091 | PF01166 | TSC-22 / Dip / Bun |
ScanRegExp | IPR000580 | 1032 | 1048 | PS01289 | TSC-22 / Dip / Bun |
![]() |
Primer_f | CGAAAGAGACGTGAGACTGAC |
---|---|
Primer_r | CTCCTGAGCATGAATTAAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |