KIAA0193

Product ID	ORK00450
Accession No	D83777
Description	secernin 1, transcript variant 2
Clone name	bh00167
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (5203 bp) Predicted protein sequence (443 aa)
HaloTag ORF Clone	FHC00450
Flexi ORF Clone	FXC00450
Source	Human adult brain
Rouge ID	mKIAA0193 by Kazusa Mouse cDNA Project
Note	We replaced ha02308, former representative clones for KIAA0193 with bh00167. (2002/5/10)

Length: 5203 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3844 bp
Genome contig ID	gi89161213r_29826268
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGCATCAAGCATACAATAAAAAAAACTGAAATT
Flanking genome sequence (99984 - 99935)	----+--------+--------+--------+--------+----* AACATCCAGTGGAGTGGCCTCTTCTGTTTTGTGTCTCGTGAATAAACGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	29926252	29995895	8	99.2	Perfect prediction

Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q12765	8e-181	100.0	Secernin-1.	Homo sapiens
BAG58182	1.5e-180	99.8	unnamed protein...	Homo sapiens
AAH40492	5.1e-180	99.8	Secernin 1 [Hom...	Homo sapiens
XP_519021	2.2e-177	98.3	secernin 1 [Pan...	Pan troglodytes
XP_001499496	1.7e-168	89.3	similar to Sece...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005322	38	388	PF03577	Peptidase C69

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGTCATTTATTGGGGAAGGTC
Primer_r	GACTGTGCAGAATGAAAAGCC
PCR product length	188 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles