KIAA0774

Product ID	ORK00129
Accession No	AB018317
Description	microtubule associated tumor suppressor candidate 2, transcript variant 1
Clone name	bh00283
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (4734 bp) Predicted protein sequence (1381 aa)
HaloTag ORF Clone	FHC00129
Flexi ORF Clone	FXC00129
Source	Human adult brain
Rouge ID	mKIAA0774 by Kazusa Mouse cDNA Project
Note	We replaced hk05183, former representative clones for KIAA0774 with bh00283. (2005/08/06)

Length: 4734 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	536 bp
Genome contig ID	gi51511729f_28396748
PolyA signal sequence (AATAGA,-12)	+--------+--------+----*----+---- TTCCCAGGAATATTTCTACCCAAAATAGAAAAAGG
Flanking genome sequence (579133 - 579182)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGATACAGAGAAGAAGCGCCTTTCAACTCACCACCAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	28496748	28975879	14	100.0	Perfect prediction

Length: 1381 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001028774	0	99.9	hypothetical pr...	Homo sapiens
XP_001117981	0	91.6	hypothetical pr...	Macaca mulatta
XP_543149	0	77.4	similar to ZK18...	Canis lupus fam...
CAH90662	3.7e-87	98.8	hypothetical pr...	Pongo abelii
AAH55016	2.1e-81	89.7	C130038G02Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033114	3.8e-17	32.0	KIAA1288

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ACCCAGATGACGCCACTACAC
Primer_r	GCAGTCTTACACGGGGATCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-