KIAA0460

Product ID	ORK05602
Accession No	AB007929
Description	regulation of nuclear pre-mRNA domain containing 2
Clone name	bj00064
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (4581 bp) Predicted protein sequence (1452 aa)
HaloTag ORF Clone	FHC05602
Flexi ORF Clone	FXC05602
Source	Human adult brain
Rouge ID	mKIAA0460 by Kazusa Mouse cDNA Project
Note	We replaced hg00776, former representative clones for KIAA0460 with bj00064. (2002/5/10)

Length: 4581 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	222 bp
Genome contig ID	gi89161185f_148503842
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGCACTTATCTACCTTCCCCAAGTTGTTTGTATT
Flanking genome sequence (208816 - 208865)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAGTAAAGAAACACAACCAAAGCCATTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	148603842	148712656	11	100.0	Perfect prediction

Length: 1452 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG51793	99.8	unnamed protein...	Homo sapiens
XP_001489528	96.3	similar to CG15...	Equus caballus
XP_540301	96.0	similar to CG15...	Canis lupus fam...
XP_860674	94.8	similar to CG15...	Canis lupus fam...
XP_860613	94.2	similar to CG15...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006903	62	125	PF04818	Protein of unknown function DUF618
HMMSmart	IPR006569	17	137	SM00582	Regulation of nuclear pre-mRNA protein

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	GTAGATAAGTGCAATGGGAGG
Primer_r	ACATTGGAAGTAGGAGTTTGG
PCR product length	163 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles