KIAA1492

Product ID	ORK00240
Accession No	AB040925
Description	dipeptidyl-peptidase 10 (non-functional), transcript variant 2
Clone name	bj00389
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (4394 bp) Predicted protein sequence (792 aa)
HaloTag ORF Clone	FHC00240
Flexi ORF Clone	FXC00240
Source	Human adult brain
Rouge ID	mKIAA1492 by Kazusa Mouse cDNA Project
Note	We replaced fj08453, former representative clones for KIAA1492 with bj00389. (2001/2/22)

Length: 4394 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2015 bp
Genome contig ID	gi89161199f_115536272
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGTATCATTTAAAAAGTATTTGCCTTTTACTGTC
Flanking genome sequence (782136 - 782185)	----+--------+--------+--------+--------+----* ATCATTTCTCTTGTTTTATTATTATTATCAATGTTTATCTATTTTTCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	115783283	116318406	23	99.4	Both No-hit

Length: 792 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515752	99.6	dipeptidyl pept...	Pan troglodytes
EAW95187	100.0	dipeptidyl-pept...	Homo sapiens
AAQ91190	99.9	dipeptidyl pept...	Homo sapiens
XP_001104553	99.2	similar to dipe...	Macaca mulatta
ABI16087	99.9	DPPY splice var...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002469	129	496	PF00930	Peptidase S9B
HMMPfam	IPR001375	576	780	PF00326	Peptidase S9

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	32	AIALLVILVVCSLITMSVILLTP	54	PRIMARY	23

Primer_f	GGCTGAGCTGCAATCTAACAC
Primer_r	TCTACTGATAACTGGCTGAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-