Gene/Protein Characteristic Table for KIAA1847
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00286
Accession No AB058750
Description zinc finger, CCCH-type with G patch domain, transcript variant 3
Clone name bm00425
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (1881 bp)
Predicted protein sequence (552 aa)
Flexi ORF Clone FXC00286
Source Human adult brain
Rouge ID mKIAA1847 by Kazusa Mouse cDNA Project
Note We replaced fh03725, former representative clones for KIAA1847 with bm00425. (2001/6/05)
Features of the cloned cDNA sequence
Description

Length: 1881 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 222 bp
Genome contig ID gi51511747f_61709260
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
TGGCAAGGACATTAAAGTGATTTCATCACAGTGTC
Flanking genome sequence
(128679 - 128728)
----+----*----+----*----+----*----+----*----+----*
ATTCAGTGGAGATCAGCTGGCTGCAGGGTCTCTGGGGAGAGAAGGGTCTG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 20 f 61809254 61837937 7 99.3 Terminal No-hit
Features of the protein sequence
Description

Length: 552 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH32612 2.7e-173 100.0 Zinc finger, CC...
Homo sapiens
CAC03670 7.4e-173 99.8 zinc finger, CC...
Homo sapiens
XP_001113808 7.1e-153 97.0 similar to zinc...
Macaca mulatta
EDL07411 5.1e-138 79.1 zinc finger, CC...
Mus musculus
Q8VDM1 1e-137 79.9 Zinc finger CCC...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000571 216 241 PF00642 Zinc finger
IPR000467 354 398 PF01585 D111/G-patch
HMMSmart IPR000571 216 241 SM00356 Zinc finger
IPR000467 352 398 SM00443 D111/G-patch
ProfileScan IPR000467 354 400 PS50174 D111/G-patch
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp