KIAA1848

Product ID	ORK00931
Accession No	AB058751
Description	SH3-domain GRB2-like endophilin B2, transcript variant 1
Clone name	bm03548
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (1985 bp) Predicted protein sequence (445 aa)
HaloTag ORF Clone	FHC00931
Flexi ORF Clone	FXC00931
Source	Human adult brain
Rouge ID	mKIAA1848 by Kazusa Mouse cDNA Project
Note	We replaced hh13792, former representative clones for KIAA1848 with bm03548. (2003/8/28)

Length: 1985 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	645 bp
Genome contig ID	gi89161216r_130710139
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTGCTCTCTAGCCAATAAACCGTCCTTGTGTGCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCACCTGGGCTCCTGTCAGGGCCTGGCCCTGAGGGTGGTAAAGGGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	130810139	130830379	11	99.2	Perfect prediction

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI12365	2e-147	100.0	SH3-domain GRB2...	Homo sapiens
CAX15002	2.9e-144	99.0	SH3-domain GRB2...	Homo sapiens
CAM23165	1.3e-143	97.0	SH3-domain GRB2...	Mus musculus
Q5PPJ9	7.8e-143	96.3	Endophilin-B2; ...	Rattus norvegicus
XP_850321	4.1e-142	97.0	similar to SH3 ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007960	6.3e-37	58.3	KIAA0491

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	389	442	PD000066	Src homology-3
FPrintScan	IPR001452	388	398	PR00452	Src homology-3
	IPR001452	402	417	PR00452	Src homology-3
	IPR001452	432	444	PR00452	Src homology-3
HMMPfam	IPR004148	49	325	PF03114	BAR
HMMPfam	IPR001452	388	444	PF00018	Src homology-3
HMMSmart	IPR004148	48	325	SM00721	BAR
HMMSmart	IPR001452	388	445	SM00326	Src homology-3
ProfileScan	IPR004148	65	332	PS51021	BAR
ProfileScan	IPR001452	385	445	PS50002	Src homology-3

Primer_f	CTCGGGTGCTCTATGACTACG
Primer_r	GCAGTTCCAAGTAGGTGACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AGACTGAGCTTGATGCCCACT
Primer_r	TTCCTGTCCAGCTTCTCATAC
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec154(1.2k) cycles