KIAA0491

Product ID	ORK00089
Accession No	AB007960
Description	SH3-domain GRB2-like endophilin B1, transcript variant 1
Clone name	ha02617
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6335 bp) Predicted protein sequence (391 aa)
HaloTag ORF Clone	FHC00089
Flexi ORF Clone	FXC00089
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0491 by Kazusa Mouse cDNA Project
Note	We replaced hh00916, former representative clones for KIAA0491 with ha02617. (1998/8/13)

Length: 6335 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4942 bp
Genome contig ID	gi89161185f_86842892
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AGGTTTCCAACTTTCATTAATAAAGTGCTTTAAAG
Flanking genome sequence (143561 - 143610)	----+--------+--------+--------+--------+----* AACATTGTGTTGCTAAATCTCGTATGTGTTCATATTTTCTCACGATAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	86942892	86986451	9	99.1	Terminal No-hit

Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y371	1.4e-142	100.0	Endophilin-B1; ...	Homo sapiens
XP_001109639	2.9e-142	99.7	SH3-containing ...	Macaca mulatta
AAF81225	2.3e-141	100.0	SH3-containing ...	Homo sapiens
Q32LM0	4.4e-137	95.9	Endophilin-B1; ...	Bos taurus
Q9JK48	7.5e-136	95.9	Endophilin-B1; ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058751	1.8e-43	58.3	KIAA1848

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	335	388	PD000066	Src homology-3
FPrintScan	IPR001452	334	344	PR00452	Src homology-3
	IPR001452	348	363	PR00452	Src homology-3
	IPR001452	378	390	PR00452	Src homology-3
HMMPfam	IPR004148	37	280	PF03114	BAR
HMMPfam	IPR001452	334	390	PF00018	Src homology-3
HMMSmart	IPR004148	36	280	SM00721	BAR
HMMSmart	IPR001452	334	391	SM00326	Src homology-3
ProfileScan	IPR004148	53	287	PS51021	BAR
ProfileScan	IPR001452	331	391	PS50002	Src homology-3

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	CCAGGGGACCATTTTAGATAC
Primer_r	ATCCCCCGAACAAACCTCAAG
PCR product length	73 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles