KIAA0678

Product ID	ORK04808
Accession No	AB014578
Description	DnaJ (Hsp40) homolog, subfamily C, member 13
Clone name	ef02254
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7595 bp) Predicted protein sequence (2257 aa)
Flexi ORF Clone	FXC04808
Source
Rouge ID	mKIAA0678 by Kazusa Mouse cDNA Project
Note	We replaced hk02710, former representative clones for KIAA0678 with ef02254. (2005/08/06)

Length: 7595 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	749 bp
Genome contig ID	gi89161205f_133519194
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TAAAAATAAAGGGAATTGACTGCTTTGTTAATGAG
Flanking genome sequence (221373 - 221422)	----+--------+--------+--------+--------+----* ATATATTTGTTCTAGTTTAATCTTTCCGTTTGAAGACCTCATATATCTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	133619194	133740565	56	99.9	Perfect prediction

Length: 2257 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516755	99.7	DnaJ (Hsp40) ho...	Pan troglodytes
AAI51247	100.0	DnaJ (Hsp40) ho...	Homo sapiens
O75165	99.9	DnaJ homolog su...	Homo sapiens
AAV41096	99.9	DnaJ domain-con...	Homo sapiens
XP_001115526	99.5	similar to DnaJ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001623	1315	1376	PF00226	Heat shock protein DnaJ
HMMSmart	IPR001623	1314	1372	SM00271	Heat shock protein DnaJ
ProfileScan	IPR001623	1315	1372	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR001412	2224	2235	PS00178	Aminoacyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1990	GELAVGGVFLRIFIAQPAWVL	2010	PRIMARY	21

Primer_f	AGCATGACTGTAGGGTTGAGC
Primer_r	AGGTTAATGATTGAGGATGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCATGACTGTAGGGTTGAGC
Primer_r	AGGTTAATGATTGAGGATGCC
PCR product length	173 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles