Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01137 |
---|---|
Accession No | AB023164 |
Description | interactor of little elongation complex ELL subunit 1 |
Clone name | ef03552 |
Vector information | |
cDNA sequence | DNA sequence (7903 bp) Predicted protein sequence (2330 aa) |
Flexi ORF Clone |
FXC01137
|
Source | |
Rouge ID |
mKIAA0947
by Kazusa Mouse cDNA Project
|
Note | We replaced hj04847 and hj04847s1, former representative clones for KIAA0947 with ef03552. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 880 bp |
---|---|
Genome contig ID | gi51511721f_5375807 |
PolyA signal sequence (AATAAA,-9) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (167518 - 167567) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 5475807 | 5543323 | 18 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
RT-PCR-ELISA |
Primer_f | GCTGTTGTTGTTGGACTTGTG |
---|---|
Primer_r | AAGTGGGTTTCTGCTAAGGGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |