Order Kazusa clone(s) from : ![]() |
Product ID | ORK01062 |
---|---|
Accession No | D87445 |
Description | SECIS binding protein 2-like, transcript variant 2 |
Clone name | eg00512 |
Vector information | |
cDNA sequence | DNA sequence (6779 bp) Predicted protein sequence (1065 aa) |
HaloTag ORF Clone |
FHC01062
![]() |
Flexi ORF Clone | FXC01062 |
Source | |
Rouge ID |
mKIAA0256
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04798, former representative clones for KIAA0256 with eg00512. (2001/10/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3474 bp |
---|---|
Genome contig ID | gi51511731r_46968259 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 47068259 | 47125922 | 17 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CTCATCCCTTCCAACCTTTAC |
Primer_r | GTACAGAAGAATCCCCACTAG |
PCR product length | 338 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |