KIAA2005

Product ID	ORK00969
Accession No	AB095926
Description	sterile alpha motif domain containing 9-like, transcript variant 1
Clone name	eg01633
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7122 bp) Predicted protein sequence (1587 aa)
HaloTag ORF Clone	FHC00969
Flexi ORF Clone	FXC00969
Source
Rouge ID	mKIAA2005 by Kazusa Mouse cDNA Project

Length: 7122 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1162 bp
Genome contig ID	gi89161213r_92497304
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGAATATTGAATAAAAAATATATTTATTTATCCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTTGTATCTCTTTGTAATGTAACTTAGATATTCTGGACTCCAAACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	92597304	92615605	5	99.9	Perfect prediction

Length: 1587 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IVG5	100.0	Sterile alpha m...	Homo sapiens
XP_527818	99.4	sterile alpha m...	Pan troglodytes
AAI27119	99.8	SAMD9L protein ...	Homo sapiens
XP_001099842	95.3	similar to ster...	Macaca mulatta
AAI27118	99.8	SAMD9L protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095925	0	60.3	KIAA2004

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001660	17	63	PS50105	Sterile alpha motif SAM

Primer_f	GAGAGATAAAGTGTACCTGTC
Primer_r	ATAGACTGGACTGCTGCTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-