Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07103 |
---|---|
Accession No | AB051554 |
Description | thyroid adenoma associated |
Clone name | eg01735 |
Vector information | |
cDNA sequence | DNA sequence (6310 bp) Predicted protein sequence (1960 aa) |
Source | |
Rouge ID |
mKIAA1767
by Kazusa Mouse cDNA Project
|
Note | We replaced fj17894, former representative clones for KIAA1767 with eg01735. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 96 bp |
---|---|
Genome contig ID | gi89161199r_43211495 |
PolyA signal sequence (CATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 43311495 | 43676617 | 38 | 99.8 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR000292 | 1500 | 1509 | PS01005 | Formate/nitrite transporter |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1776 | FCQVDASIALALALAVLCDLLQQ | 1798 | PRIMARY | 23 | 2 | 1843 | FWAETLIFVKYLCKHLFCLLSKS | 1865 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CCCATCCTATTCTTGAGTTGC |
---|---|
Primer_r | TGGCAGGTATTTTCTTGTGAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |