Gene/Protein Characteristic Table for KIAA2032
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00312
Accession No AB107354
Description proline and serine rich 1
Clone name eh00720
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (5168 bp)
Predicted protein sequence (952 aa)
Flexi ORF Clone FXC00312
Source
Rouge ID mKIAA2032 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5168 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1499 bp
Genome contig ID gi51511729r_38382003
PolyA signal sequence
(CATAAA,-21)
+----*----+----*----+----*----+----
CTTAAATCTATACCCATAAAACTTCTTTTAAGATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATTGTGTTTTTTATATATGTTGACCATTCATTCAGAAAATAATTATTG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 13 r 38482003 38510213 13 99.7 Perfect prediction
Features of the protein sequence
Description

Length: 952 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX08610 0 97.7 chromosome 13 o...
Homo sapiens
XP_001087439 0 96.4 hypothetical pr...
Macaca mulatta
BAH13093 0 99.9 unnamed protein...
Homo sapiens
XP_001087318 0 94.1 hypothetical pr...
Macaca mulatta
XP_001086735 0 95.6 hypothetical pr...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp