Gene/Protein Characteristic Table for KIAA2022
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05747
Accession No AB095942
Description KIAA2022
Clone name ff04229
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (10624 bp)
Predicted protein sequence (1520 aa)
Source Human fetal brain
Rouge ID mKIAA2022 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 10624 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 5828 bp
Genome contig ID gi89161218r_73770137
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GTTATTGTTTATGAAATAAATAAAAAGAAAAGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATACTGCTTTAGAATCATATGTATTAGAAATCAAACCATTTCTAATT
Features of the protein sequence
Description

Length: 1520 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001096699 0 97.9 similar to DNA ...
Macaca mulatta
XP_549086 0 90.3 similar to DNA ...
Canis lupus fam...
XP_217568 0 86.4 similar to DNA ...
Rattus norvegicus
EDL14086 0 85.1 mCG1188 [Mus mu...
Mus musculus
BAC30074 0 89.6 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAGGATTGGGGTTACTTCGAG
Primer_r TCGAATTTTCAGGGAGCAGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp