KIAA1673

Product ID	ORK00263
Accession No	AB051460
Description	cytoplasmic polyadenylation element binding protein 4
Clone name	fg00690
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6380 bp) Predicted protein sequence (712 aa)
HaloTag ORF Clone	FHC00263
Flexi ORF Clone	FXC00263
Source	Human fetal brain
Rouge ID	mKIAA1673 by Kazusa Mouse cDNA Project

Length: 6380 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4173 bp
Genome contig ID	gi51511721f_173149285
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTGAGATGTTGAATGAATAAAACTTTTAACTCAG
Flanking genome sequence (170635 - 170684)	----+--------+--------+--------+--------+----* ATTTCTTTTAATATACTTATTTCTTTTTAACACAAGTAGATGATGCTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	173249275	173319918	9	99.3	Perfect prediction

Length: 712 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001097943	99.9	similar to cyto...	Macaca mulatta
XP_866373	99.6	similar to cyto...	Canis lupus fam...
CAI24338	98.3	cytoplasmic pol...	Mus musculus
AAI43960	98.9	Unknown (protei...	Homo sapiens
XP_866358	98.5	similar to cyto...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023157	2.6e-59	60.1	KIAA0940

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	457	518	PF00076	RNA recognition motif
HMMSmart	IPR000504	456	528	SM00360	RNA recognition motif
HMMSmart	IPR000504	564	637	SM00360	RNA recognition motif
ProfileScan	IPR000504	455	542	PS50102	RNA recognition motif
ProfileScan	IPR000504	563	641	PS50102	RNA recognition motif

Primer_f	CAAACATAGAAAGGGAGCTGC
Primer_r	GTAGGAACAGCACGATAGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CAAACATAGAAAGGGAGCTGC
Primer_r	GTAGGAACAGCACGATAGCAC
PCR product length	209 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles