KIAA0940

Product ID	ORK00691
Accession No	AB023157
Description	cytoplasmic polyadenylation element binding protein 3, transcript variant 2
Clone name	hh04894
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5715 bp) Predicted protein sequence (699 aa)
HaloTag ORF Clone	FHC00691
Flexi ORF Clone	FXC00691
Source	Human adult brain
Rouge ID	mKIAA0940 by Kazusa Mouse cDNA Project

Length: 5715 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3571 bp
Genome contig ID	gi89161187r_93698379
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGGATAATTGGGTAATAAAATGACAGAATGAGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATGTGAGATTTTGAGAAGCCTTTTCCTTTATCACAGTGGTTTAGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	93798379	93992983	10	99.3	Perfect prediction

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI13637	4e-185	100.0	cytoplasmic pol...	Homo sapiens
XP_001145214	1.2e-184	99.9	cytoplasmic pol...	Pan troglodytes
XP_001088983	7.9e-183	98.8	similar to cyto...	Macaca mulatta
XP_543930	7.4e-181	97.7	similar to cyto...	Canis lupus fam...
BAE36436	1.8e-138	94.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051460	4.8e-38	59.9	KIAA1673

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	444	505	PF00076	RNA recognition motif
HMMSmart	IPR000504	443	515	SM00360	RNA recognition motif
HMMSmart	IPR000504	551	624	SM00360	RNA recognition motif
ProfileScan	IPR000504	442	529	PS50102	RNA recognition motif
ProfileScan	IPR000504	550	628	PS50102	RNA recognition motif

Primer_f	GCATAAAGCTAAAGTGAAGGC
Primer_r	TCAGTCGCGCACAATCAACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCATAAAGCTAAAGTGAAGGC
Primer_r	TCAGTCGCGCACAATCAACAC
PCR product length	153 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles