KIAA1294

Product ID	ORK05232
Accession No	AB037715
Description	FERM domain containing 4A
Clone name	fg01155
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6816 bp) Predicted protein sequence (1051 aa)
Source	Human fetal brain
Rouge ID	mKIAA1294 by Kazusa Mouse cDNA Project

Length: 6816 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3327 bp
Genome contig ID	gi89161187r_13625718
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTGTTGTCAACACTTATTAAAGCATTTTCAAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGATCCCAGCTGCCTCCTGGAGATTTTGTTCCTTTGTCTGTCAGCGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	13725718	14412889	25	99.4	Perfect prediction

Length: 1051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51245	100.0	FERM domain con...	Homo sapiens
Q9P2Q2	99.9	FERM domain-con...	Homo sapiens
EAW86275	99.9	FERM domain con...	Homo sapiens
XP_001143334	99.8	hypothetical pr...	Pan troglodytes
XP_507665	99.8	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023230	2.7e-86	48.8	KIAA1013

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000299	65	77	PR00935	Band 4.1
	IPR000299	145	165	PR00935	Band 4.1
	IPR000299	213	229	PR00935	Band 4.1
HMMPfam	IPR000299	34	233	PF00373	Band 4.1
HMMSmart	IPR000299	28	233	SM00295	Band 4.1
ProfileScan	IPR000299	32	334	PS50057	Band 4.1
ScanRegExp	IPR000299	86	117	PS00660	Band 4.1
ScanRegExp	IPR000299	203	232	PS00661	Band 4.1

Primer_f	CCTATGTAAACTGGTGTCCTC
Primer_r	GCTAACAGTACCCTCTATGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-