KIAA1195

Gene/Protein Characteristic Table for KIAA1195

Order Kazusa clone(s) from :

Product ID	ORK00761
Accession No	AB033021
Description	F-box protein 40
Clone name	fg01739
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5927 bp) Predicted protein sequence (717 aa)
HaloTag ORF Clone	FHC00761
Flexi ORF Clone	FXC00761
Source	Human fetal brain
Rouge ID	mKIAA1195 by Kazusa Mouse cDNA Project

Length: 5927 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3383 bp
Genome contig ID	gi89161205f_122694656
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCTAGAAGAGGAAATAAAAGCTGCTTTGCACTCTG
Flanking genome sequence (137175 - 137224)	----+--------+--------+--------+--------+----* AAAGGCTAATTGGGTGAATCTTATAAGTTAGGTCTAGAGACAGATGTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	122794656	122831829	4	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 717 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UH90	100.0	F-box only prot...	Homo sapiens
XP_526281	99.4	F-box protein 4...	Pan troglodytes
AAF17085	99.6	muscle disease-...	Homo sapiens
XP_001111331	97.7	F-box protein 4...	Macaca mulatta
XP_545126	86.8	similar to F-bo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	579	626	PF00646	Cyclin-like F-box
ProfileScan	IPR001293	62	104	PS50145	Zinc finger
ProfileScan	IPR001810	578	632	PS50181	Cyclin-like F-box

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAATTCAGATGCCACTCGATG
Primer_r	ATCAATGTGGCACTATGGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 3

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGGCAAGACAGCTAGAAGTGG
Primer_r	AGACCTCAGCCTCCATATTCG
PCR product length	167 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp