KIAA1197

Product ID	ORK00762
Accession No	AB033023
Description	YEATS domain containing 2
Clone name	fg01844
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6501 bp) Predicted protein sequence (1487 aa)
HaloTag ORF Clone	FHC00762
Flexi ORF Clone	FXC00762
Source	Human fetal brain
Rouge ID	mKIAA1197 by Kazusa Mouse cDNA Project

Length: 6501 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2037 bp
Genome contig ID	gi89161205f_184798300
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTAACAAAATTGTCTACAATAAATCTTTTGGTATT
Flanking genome sequence (214804 - 214853)	----+--------+--------+--------+--------+----* TGTGGTGGGTGTTTCTGAGTTTGAAGCATGGTACTCAGGCAGGGTTCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	184898300	185013102	31	100.0	Perfect prediction

Length: 1487 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001135033	0	96.5	YEATS domain co...	Pan troglodytes
Q9ULM3	0	100.0	YEATS domain-co...	Homo sapiens
XP_001915718	0	94.4	similar to YEAT...	Equus caballus
XP_001366314	0	80.8	similar to YEAT...	Monodelphis dom...
AAI53294	1.7e-214	93.1	YEATS2 protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005033	296	380	PF03366	YEATS
ProfileScan	IPR005033	272	382	PS51037	YEATS

Primer_f	CAGCCAGTGCAGACCTTAACC
Primer_r	GTAGAGTTTAGTGCCAGGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-