Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00258 |
---|---|
Accession No | AB046844 |
Description | G protein-coupled receptor 107, transcript variant 1 |
Clone name | fg02331 |
Vector information | |
cDNA sequence | DNA sequence (6840 bp) Predicted protein sequence (599 aa) |
HaloTag ORF Clone |
FHC00258
|
Flexi ORF Clone | FXC00258 |
Source | Human fetal brain |
Rouge ID |
mKIAA1624
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 5039 bp |
---|---|
Genome contig ID | gi89161216f_131756035 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (186227 - 186276) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 131856035 | 131942260 | 20 | 99.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR009637 | 214 | 552 | PF06814 | Transmembrane receptor |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 19 | GLRLLPMLGLLQLLAEPGLGRVH | 41 | SECONDARY | 23 | 2 | 263 | KLYISMAFFFFLSGTIWIHIL | 283 | PRIMARY | 21 | 3 | 329 | AVVYYITHLLKGALLFITIALIG | 351 | PRIMARY | 23 | 4 | 368 | IFMIVIPLQVLANVAYIIIESTE | 390 | SECONDARY | 23 | 5 | 401 | DSLFLVDLLCCGAILFPVVWSIR | 423 | PRIMARY | 23 | 6 | 496 | YYVLIVCYIYFTRIIAFLLKLAV | 518 | PRIMARY | 23 | 7 | 523 | KWLYQLLDETATLVFFVLTGYK | 544 | SECONDARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | CATTTGCTTTCCTGGTTAGAG |
---|---|
Primer_r | CAACACGGCAAGAGAATTCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |