KIAA1976

Product ID	ORK05738
Accession No	AB075856
Description	Homo sapiens mRNA for KIAA1976 protein.
Clone name	fg02988
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6495 bp) Predicted protein sequence (351 aa)
Source	Human fetal brain
Rouge ID	mKIAA1976 by Kazusa Mouse cDNA Project

Length: 6495 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1615 bp
Genome contig ID	gi51511721f_176134009
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCGTGAATGTAAATAAATTATATATATATATTGCT
Flanking genome sequence (106496 - 106545)	----+--------+--------+--------+--------+----* AACCTGAGTGCTACTTCTCTCAGGGAAAGCCAGGGAGCAAGGCCAAATGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	176234009	176240503	1	99.0	Perfect prediction

Length: 351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_861315	2.3e-20	52.9	similar to unc-...	Canis lupus fam...
CAF99225	9e-20	51.5	unnamed protein...	Tetraodon nigro...
AAI22557	9.2e-16	78.4	UNC5A protein [...	Homo sapiens
AAH09333	9.3e-16	78.4	UNC5A protein [...	Homo sapiens
AAI57825	1.3e-15	78.4	Unc-5 homolog A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB055056	0.001	32.0	KIAA1777

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	GTTTTCTGTGCCTGAGCTAGC
Primer_r	AAGACTGCCGTGCTGACCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-