KIAA1674

Product ID	ORK00885
Accession No	AB051461
Description	leucine rich repeat containing 27, transcript variant 1
Clone name	fg03838
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6382 bp) Predicted protein sequence (538 aa)
HaloTag ORF Clone	FHC00885
Flexi ORF Clone	FXC00885
Source	Human fetal brain
Rouge ID	mKIAA1674 by Kazusa Mouse cDNA Project

Length: 6382 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	4684 bp
Genome contig ID	gi89161187f_133895694
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTGCAGATGAGCCACATAGCCTAGAAATATCTG
Flanking genome sequence (147720 - 147769)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAGTTATGTCATGAATGCATAAAATATACAGACCATACAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	133995694	134043412	11	99.2	Perfect prediction

Length: 538 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9C0I9	5.3e-180	100.0	Leucine-rich re...	Homo sapiens
BAG53467	1.1e-179	99.8	unnamed protein...	Homo sapiens
XP_001144456	1.2e-170	95.8	leucine rich re...	Pan troglodytes
XP_001092022	1.3e-160	90.6	similar to leuc...	Macaca mulatta
CAI13019	1.1e-155	100.0	novel protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001611	76	98	PF00560	Leucine-rich repeat
	IPR001611	100	121	PF00560	Leucine-rich repeat
	IPR001611	123	144	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	74	97	SM00369	Leucine-rich repeat
	IPR003591	98	121	SM00369	Leucine-rich repeat
	IPR003591	122	144	SM00369	Leucine-rich repeat

Primer_f	CAAGGAGGATGAGCTGCTGTC
Primer_r	AAGATGATGCCTCCAACACCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCACAATGCCACCTGACTGAG
Primer_r	GTGGCCTTTGGTGTAACTCTC
PCR product length	216 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles